We narrowed to 1,076 results for: TOR
-
TypeCollection...popular empty backbones, expression vectors for transactivators, and vectors for other applications, or search...transcription factors to further minimize background expression. Improved expression of the transactivator proteins...should also choose between: Dual vector system: express the transactivator and the tet-controlled gene of...both the transactivator and the tet-controlled gene of interest from one plasmid. A single vector approach...generations of transactivators and promoters are generally cross-compatible. Your choice of transactivator, promoter...Request service available for many transactivator or tet-inducible vectors. Tetracycline-inducible Backbones...Lentiviral Tet-Off vector for repressible expression with blasticidin selection. *Note: this vector contains an...
-
Brain Initiative Collection
TypeCollection... the E2 regulatory element Jordane Dimidschstein 135630-AAV9 pAAV-S5E2-dTom-nlsdTom AAV vector to drive...the E2 regulatory element Jordane Dimidschstein 135630-PHPeB pAAV-S5E2-dTom-nlsdTom AAV vector to drive...of the E2 regulatory element Jordane Dimidschstein 135631-AAV1 pAAV-S5E2-GFP-fGFP AAV vector to drive ...of the E2 regulatory element Jordane Dimidschstein 135631-AAV9 pAAV-S5E2-GFP-fGFP AAV vector to drive ...of the E2 regulatory element Jordane Dimidschstein 135631-PHPeB pAAV-S5E2-GFP-fGFP AAV vector to drive ...of the E2 regulatory element Jordane Dimidschstein 135632-AAV1 pAAV-S5E2-GCaMP6f AAV vector to drive the...of the E2 regulatory element Jordane Dimidschstein 135632-AAV9 pAAV-S5E2-GCaMP6f AAV vector to drive the... -
Trimmer Lab NeuroMab Collection
TypeCollection...GFP Aequorea victoria Mouse IgG2a 188167 Anti-IP3 receptor, type 1 [L24/21R] IP3 receptor, type 1 Rat ...in a new window) together with the laboratory of NeuroMab Director, Dr. James Trimmer, have produced numerous...Anti-GluA1/GluR1 glutamate receptor [N355/1R] GluA1/GluR1 glutamate receptor Rat Mouse IgG2a 114484 Anti-Stonin... IgG2a 114488 Anti-Dopamine D3 receptor [N331/19R] Dopamine D3 receptor Human Mouse IgG2a 114490 Anti-...Anti-GluN2B/NR2B glutamate receptor [N59/36.1R] GluN2B/NR2B glutamate receptor Rat Mouse IgG2a 114509 Anti-Pan-FHF-A...Anti-GluK5/Grik5/KA2 kainate receptor [N279B/27R] GluK5/Grik5/KA2 kainate receptor Rat Mouse IgG2a 149452 Anti-Kirrel3... IgG2a 177509 Anti-Dopamine D2 receptor [N186/29R] Dopamine D2 receptor Rat Mouse IgG2a 177510 Anti-SAP102... -
Ras Pathway
TypeCollection...INSR Insulin receptor INSRR Insulin receptor-related receptor IRS IRS1 IRS2 Insulin receptor substrate JUN...transcription factor ECT2 Epithelial cell transforming 2 EGFR Epidermal growth factor receptor EIF4EBP EIF4EBP1...proto-oncogene, receptor tyrosine kinase MLST8 MTOR associated protein, LST8 homolog MTOR Mechanistic target...Ribosomal protein S6 kinase B1 RPTOR Regulatory associated protein of MTOR, complex 1 SAV1 Salvador family... Frederick National Laboratory for Cancer Research . Frederick National Laboratory for Cancer Research...Eukaryotic translation initiation factor 4E binding protein ERBB2 Erb-b2 receptor tyrosine kinase 2 ERK MAPK1... -
Caltech Systemic Capsids
TypeCollection...eYFP E2 regulatory element Activator C1V1 Dimidschstein 135634 pAAV-S5E2-ChR2-mCherry E2 regulatory element... Viral Vector Packaging Service AAV Caltech Systemic Capsids Viral Vector Packaging Service...CLOVER Center’s repository of published capsid use (Link opens in a new window) . Viral Vectors 101: Systemic...dTom-nlsdTom E2 regulatory element dTomato Control Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory element...mCherry Syn Activator, Cre-dependent DREADD Roth 44362 pAAV-hSyn-DIO-hM4D(Gi)-mCherry Syn Inhibitor, Cre-dependent...Roth 135635 pAAV-S5E2-Gq-P2A-dTomato E2 regulatory element Activator DREADD Dimidschstein Biosensors 104491...EF1a Activator, Cre-dependent ChR2 Deisseroth 127090 pAAV-CAG-DIO-ChR2(H134R)-eYFP CAG Activator, Cre-... -
Plasmids for Stem Cell Research
TypeCollection...generation vectors for transcription factor mediated differentiation of iPSCs into cortical and motor neurons...lentiviral vector for the expression of human Oct4, Sox2, and Klf4 Polycistronic lentiviral vector for "hit...lentiviral vectors for human iPSC generation OCT4 and SOX2 Work as Transcriptional Activators in Reprogramming...Fibroblasts Hematopoietic Progenitor Cells Lentiviral Human Cooperative Transcription Factor Induction Mediates...Fibroblasts Oligodendrocyte Progenitor Cells Lentiviral Mouse Transcription factor-mediated reprogramming ...Rapid Ngn2-induction of excitatory neurons from hiPSC-derived neural progenitor cells. Methods. 2015 Nov...iPSCs Cortical or Lower Motor Neurons CRISPR/TALEN Human Transcription Factor-Mediated Differentiation... -
TALEN Plasmids and Kits
TypeCollection...contains modified pFUS array vectors, destination vectors and a reporter vector for mammalian cell-based ...engineering. Fusions of transcription activator-like (TAL) effectors of plant pathogenic Xanthomonas spp...UTRs are included in the vector to enhance expression of the message. Both vectors utilize homodimeric FokI...the Golden Gate TALEN and TAL Effector Kit. These modified pFUS vectors can reduce the number of module...Destination vectors, pcDNA-TAL-NC2 and pCAGGS-TAL-NC2, are mammalian expression/mRNA synthesis vectors containing... These new destination vectors can be used to create TALE-transcription factors and are used at the final... of polymorphic amino acid repeats in the TAL effectors. View Addgene's TALEN Guide. These collections... -
Retrograde AAV viral preps
TypeCollection...Dopamine Optogenetics Activators Inhibitors Bidirectional DREADDs Activators Inhibitors Other Molecular Tools... Viral Vector Packaging Service AAV Retrograde AAV Viral Vector Packaging Service: Retrograde...the Alla Karpova and David Schaffer laboratories. These viral vector preparations were produced with the...-EYFP Syn Activator Optogenetics Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG Activator Optogenetics...CamKII Activator Optogenetics Deisseroth 55645 pAAV-hSyn Con/Fon hChR2(H134R)-EYFP Syn Activator, Cre and...(H134R)-GFP Syn Activator Optogenetics Boyden 59170 pAAV-Syn-Chronos-GFP Syn Activator Optogenetics Boyden...mCherry-Fishell-3 mDIx Activator Optogenetics Fishell 65014 pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Inhibitor Optogenetics... -
CRISPR Guide
TypeCollection...classes of base editors were cytosine base editors (purine-to-purine) and adenine base editors (pyrimidine-to-pyrimidine...base editors that can catalyze base transversions. These editors are based on cytosine base editors and...finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required scientists ...base editors, the evolved TadA domain is fused to Cas9n or dCas9 to create the adenine base editor. The...systems use a type V-K Cas effector, Cas12k. No matter the system, the Cas effectors lack nuclease activity...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...co-expression of epitope-tagged dCas9 and antibody-activator effector proteins; long-term imaging of proteins in... -
Bacterial Expression Systems
TypeCollection...expression vector containing N-terminal, TEV cleavable, 6x-His and thioredoxin tags. Other empty vectors for ...transcription factor binding to reporter plasmid pH3U3-zif268 (omega) . Transcription factors are expressed...Strains Why Bacteria? E. coli are commonly used to store and replicate plasmids of all types, but beyond ...many interesting questions. Does my transcription factor bind to a particular sequence? Do these two proteins...fluorescent protein tags whose localization you can monitor in live cells (beware of artifacts!), photoactivatable...blotting or staining, and RNA transcript tags to monitor RNA localization. Using these plasmids you’ll hopefully...PIs Fluorescent protein fusion: contains empty vectors with N and C-terminal fluorescent protein tags ... -
Cre-lox system
TypeCollection...Cre-ERT2 - Tamoxifen inducible; Gateway entry vector none Entry Vector Zon 27493 pBT140 Cre CMV Mammalian Luo...Cre-ERT2;Targeting vector for Fos locus Mammalian Luo 46389 pArcCreER Cre-ERT2;Targeting vector for Arc locus...Burgess 61570 Pvalb-2A-Cre targeting vector Cre; Targeting vector for Pvalb locus Mammalian Zeng 61573...61573 Rasgrf2-2A-dCre targeting vector DHFR-destabilized Cre; targeting vector for Rasgrf2 Mammalian Zeng ...Zeng 61574 Slc17a7-IRES2-Cre targeting vector Cre; Targeting vector for Slc17a7 locus Mammalian Zeng 62219...Nxph4-2A-CreERT2 Targeting Vector Cre-ERT2 - Tamoxifen inducible; Targeting vector Mouse Nxph4 Mammalian Zeng...pRRlsinPGK_CREGFP_WPRE Cre-GFP fusion PGK Lentiviral Torok-Storb 99249 pVAX1/mTyr-Cre Cre Tyrosinase Mammalian... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection...full sequencing of the final viral vector preparation. These viral vector preparations were produced with...Intravitreal delivery of a novel AAV vector targets ON bipolar cells and restores visual function in a mouse model...of Primary Human Hematopoietic Stem/Progenitor Cells by AAV6 Vectors: Strategies for Overcoming Donor-Variation...quality AAV preps from select plasmids in the repository. Browse the University of Florida serotype testing... Viral Vector Packaging Service AAV University of Florida Serotype...Serotype Testing Panel for the Eye and Brain Viral Vector Packaging Service: University of Florida Serotype ... -
Viral Production
TypeCollection... with viral vector manufacturing facilities, such as the University of Pennsylvania Vector Core (Link ...Pennsylvania Vector Core. In general, titering is performed by the facility that produced the viral vector lot....Empty vector particles can be identified after negative staining and appear darker than full vector particles...Electron micrograph of AAV vector preparation shows that the vast majority of the vectors consist of full particles... Viral Vector Packaging Service Viral Production Viral Production...vivo studies. Preparations are then aliquoted and stored at -80 °C. Titer Titering is either performed by...to determine which facility produced your viral vector lot. At Addgene, AAV particles are titered by droplet... -
Chemogenetics Plasmids
TypeCollection...cells expressing these engineered receptors. Chemogenetic receptors are popular in neuroscience, where...pathway the engineered receptor is coupled to and the specific cell type where the receptor is expressed, these...contains two main classes of chemogenetic receptors: Designer Receptors Exclusively Activated by Designer Drugs...Selective Actuator Modules (PSAMs). DREADDs are the most widely used chemogenetic receptors and are G-...Gi) and KORD are inhibitory. PSAMs are engineered α7 nicotinic acetylcholine receptor (nAChR) domains ...chemogenetic resources available at Addgene. See our inventory of chemogenetic constructs, including DREADD constructs...Service: Chemogenetics AAV Blog: Chemogenetics Viral Vectors 101 Blog: Chemogenetics vs. Optogenetics Chemogenetics... -
Zhang Lab CRISPR Page
TypeCollection... in two formats: 1 vector system - lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9...Expresses dCAS9-VP64 activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with...lentiviral vector encoding dCAS9-VP64 with 2A Blast resistance marker 61426 : lentiviral vector encoding...Nature 2015). The dual vector system uses S. pyogenes Cas9 (SpCas9), using one vector to express SpCas9, ...61408 : Targeting vector for the mouse Rosa26 locus; Used to make Cas9 knockin mouse Vectors for cancer modeling...SpCas9 or SpCas9n, and the single guide RNA. The vector can be digested using BbsI, and a pair of annealed...indicated below) can be cloned scarlessly into the vector before the sgRNA scaffold. The oligos are designed... -
Viral Prep Service for Plasmids and Pooled Libraries
TypeCollection...technologies. Penn Vector Core AAV Vectors Many AAV vectors from the Penn Vector Core have been transferred to Addgene... Viral Vector Packaging Service Addgene produces high-quality viral vector preps from select...and we’ll make the viral vector prep you need. Packaged on Request Viral Vector Packaging Service Information...about viral vector production at Addgene, ordering information, and more. Additional Viral Vector Resources...when you receive your viral vector from Addgene, with details about storage. Biosafety Guide Documentation...biosafety of viral vectors, and general biosafety guidelines. Addgene Blog: Viral Vector Posts Content from...aspects of viral vectors, including troubleshooting advice and explanations of viral vector technologies.... -
TALEN Guide
TypeCollection...never happen. Yet with transcription activator-like (TAL) effectors, scientists in several biological disciplines... and help can be found at TALeffector Resources Center (www.taleffectors.com) . Whether you work in a ...between two distinct ZF target sites. (B) A TAL effector nuclease (TALEN). Similar in principle to the ...published the nucleotide recognition code of the TAL effectors, which were isolated from the plant bacterial ...that determines which single nucleotide the TAL effector will recognize: ( Figure 1B ) HD targets cytosine... in your average genome are every 500 bp. TAL effectors have some restrictions (for example, the target...determining the importance of context for each TAL effector within an array, but early studies suggest the... -
p53 Pathway
TypeCollection... Tumor necrosis factor receptor superfamily, member 10b E2F-1 E2F transcription factor 1 Fas Fas cell ... PAI Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 PERP...p14ARF Cyclin-dependent kinase inhibitor 2A p21 Cyclin-dependent kinase inhibitor 1A p48 Damage-specific DNA...plasmids for the p53 pathway. p53 is a transcription factor and tumor suppressor activated by cellular stress...Pathway You May Also Like: Cancer Pathway ORF Kit mTOR pathway Ras pathway Background p53 Pathway Plasmids...List References Background p53 is a transcription factor and tumor suppressor activated by cellular stresses..., which disrupt its interaction with negative regulators, increase its stability and DNA binding activity... -
Validated gRNA Sequences
TypeCollection...EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria GAAGTTCGAGGGCGACACCC... EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria GATGCCGTTCTTCTGCTTGT... EGFP A. victoria GGAGCGCACCATCTTCTTCA 51763 cut S. pyogenes 24336571 Zhang EGFP A. victoria GGCCACAAGTTCAGCGTGTC...EGFP A. victoria GGCGAGGGCGATGCCACCTA 61051 cut S. pyogenes 24179142 Del Bene EGFP A. victoria GGGCACGGGCAGCTTGCCGG... EGFP A. victoria GGGCACGGGCAGCTTGCCGG 47511 cut S. pyogenes 23792628 Joung EGFP A. victoria GGGCGAGGAGCTGTTCACCG... EGFP A. victoria GGTGAACCGCATCGAGCTGA 51765 cut S. pyogenes 24336571 Zhang EGFP A. victoria GGTGGTGCAGATGAACTTCA... GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria GGAGCGCACCATCTTCTTCA... -
Neurodegeneration Research Collection
TypeCollection...upper and lower motor neurons in the brain and spinal cord. Over time, a loss of motor neurons leads to...AIS) plasticity with a motor neuron-specific reporter and a PAX7 inducible vector . Harley et al. Cell ...tet-inducible expression of transcription factors for sensory, motor, and cortical neuron differentiation....CRISPR Tools AAV Viral Preps iPSC Differentiation Factors Antibodies Fluorescent Proteins Other Resources...95%) of ALS are sporadic, having no prior family history. A small percentage (5-10%) are familial ALS cases...portion of cases can be attributed to known genetic factors such as defects in LRRK2, SNCA, PARK7, or PINK1... gene variation and lifestyle or environmental factors. For example, variations of Apolipoprotein E (APOE...