We narrowed to 144 results for: MYC;
-
TypeCollection...YET Cre is coexpressed with tdTomato and Pac (puromycin N-acethyl-transferase) pCDH-CB-copGFP-T2A-iCre...pCDH-CB-FLPe-P2A-copGFP-T2A-Puro 72258 Expresses FLPe, copGFP and the puromycin resistance from the CB promoter pCDH-CB-FLPe-P2A-tdTomato...-copGFP-T2A-Puro 72263 Express copGFP and the puromycin resistance gene from the EF1 promoter pCDH-CMV-mCherry-T2A-Puro...pCDH-CMV-mCherry-T2A-Puro 72264 Express mCherry and puromycin resistance gene from the CMV promoter pCDH-CMV...
-
Lentivirus Plasmids
TypeCollection...-pLKO-puro 3rd inducible expression of shRNA; puromycin selection. See plasmid 21916 for Neo selection...cDNA expression, gateway plasmid, constitutive Hygromycin resistance gene coexpression. See article for...19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895 pLX301 3rd Gateway plasmid for ...Tet-pLKO-neo 3rd inducible expression of shRNA; neomycin selection. See plasmid 21915 for Puro resistance... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...pyogenes URA3 Wyrick pCRISPomyces-2 61737 Bacteria BbsI yes, cut S. pyogenes Apramycin Zhao pRB1017 59936...none S. pyogenes Zon pCRISPomyces-1 61736 Bacteria BbsI yes, cut S. pyogenes Apramycin Zhao pMB70 47943 Worm...activate, interfere, or nick. Selection , such as Puromycin or EGFP Cloning enzyme used for insertion of your... -
Microbiology Resources
TypeCollection... Helicobacter pylori Listeria monocytogenes Mycobacterium sp. Neisseria sp. Pseudomonas sp. Ralstonia ...application and by color. External Resources European Saccharomyces Cerevisiae Archive for Functional Analysis (...Reagent Program (Link opens in a new window) Saccharomyces Genome Database (SGD) (Link opens in a new window... -
Botman-Teusink Yeast FP Collection
TypeCollection...cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast. 2004 Jun;21(8):661-70. doi...antibiotic selection markers for engineering in Saccharomyces cerevisiae. Microb Cell Fact. 2013 Oct 25;12... -
Control AAV Preps
TypeCollection...dependent 8 Deisseroth 98927 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 CAG GFPsm_myc (does not fluoresce) Cre ... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...Addgene plasmid ID 48139), which include GFP and puromycin as selectable markers, respectively, or constructs...consists of DMEM supplemented with 2% penicillin/ streptomycin and 1% L-glutamine, which is used for MEL cells... -
Penn Vector Core Partnership with Addgene
TypeCollection...Loren Looger AV-1-PV3661 98927-AAV1 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 Control Loren Looger AV-10-PV0101...Boyden AV-1-PV3511 98926-AAV1 pAAV.CAG.GFPsm-myc.WPRE.SV40 Loren Looger AV-1-ALL856 100048-AAV1 pAAV.CAG.LSL.tdTomato... -
Fluorescent Protein Guide: In Vivo Imaging
TypeCollection....4 pcDNA3-mNeptune-N E2-Crimson 611/646 28.98 pEF.myc.ER-E2-Crimson Near-Infrared Protein Excitation/Emission... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...reporter vector expressing firefly luciferase with neomycin resistance. Other Resources Protocols Bloom lab... -
Malate Dehydrogenase CUREs Community Collection
TypeCollection...Organism or species (e.g., human, watermelon, Streptomyces ) Subcellular compartment (chloroplastic, cytoplasmic... -
Retrovirus Plasmids
TypeCollection... For cloning and gene expression; select with puromycin or screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE... -
CRISPR Plasmids - Drosophila
TypeCollection...Port 49330 pAc-sgRNA-Cas9 dU6 BspQI Transfection Puromycin yes, cut Ji-Long Liu 45946 pU6-BbsI-chiRNA dU6... -
CRISPR Plasmids - Prime Edit
TypeCollection...-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222 pPBT-PE2-PuroTK-pegRNA_GG... -
CRISPR Plasmids - Bacteria
TypeCollection...NGG) 42875 pCRISPR BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9... -
CRISPR Plasmids - Plants
TypeCollection... As Cpf1 Qi 91715 pKEE401 yes, cut S. pyogenes Neomycin Chen Do you have suggestions for other plasmids... -
Ras Pathway
TypeCollection...protein, LST8 homolog MTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 NFE2L2 Nuclear factor, erythroid... -
CRISPR References and Information
TypeCollection...cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TGGAAGCGGACGCGAGTCaagtcacctctggaagCCTGAACGATTCGCAACA mycn TAL3124 & TAL3125 TGCAGCCGTGTTTCTACCcggacgaggatgacttCTACTTCTGCAGACCAGA... -
CRISPR History and Development for Genome Engineering
TypeCollection...and rat) Bacteria ( E. coli , Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...multicistronic expression of GFP and/or mCherry, with neomycin cassette Zebrafish, Sea urchin, Xenopus, and C... -
Gamma-Retroviral Vector Guide
TypeGuide... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance... -
Validated gRNA Sequences
TypeCollection...GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes 26178787... -
Lentiviral Vector Guide
TypeGuide... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...