...Description 44246 pdCas9-humanized A catalytically inactive, human codon-optimized Cas9 expression plasmid...plasmid 44247 pdCas9::BFP-humanized A catalytically inactive, human codon-optimized Cas9-BFP fusion expression...constructs 44249 pdCas9-bacteria A catalytically inactive bacterial Cas9 expression plasmid 44250 pwtCas9...

...as they receive their AAV prep from Addgene — eliminating the steps to produce, purify, and titer viral...research-grade use. Many chemogenetic, optogenetic, recombinase, and biosensor transfer plasmids in our repository...vivo testing. We recommend that you consult the original paper of your chosen AAV plasmid for more information...

...virus, plasmids expressing both the Cre and Flp recombinases to remove genes flanked by either loxP or frt...gene of interest from the PGK (phosphoglycerate kinase I) promoter pCDH-CMV4 72284 Express gene of interest...variety of reporters as well as the Cre and Flp recombinases. Genes can be cloned into these transfer vectors...

...Aqua Cyan Bacterial Expresses Aquamarine with N-terminal His tag pAquaN1 Cyan Mammalian Expresses mammalian...pCyPet-His Cyan Bacterial Expresses CyPet with C-terminal His tag SCFP3A Cyan Mammalian Express a gene of...pYPet-His Yellow Bacterial Expresses YPet with C-terminal His tag SYFP2 Yellow Mammalian Express a gene ...

...Stable RNA <8 Kb 80-130 Dividing Yes Moderate * Recombinant AAV has a low frequency of target cell genome... Lab Lentivector Toolbox Guide to Generating Recombinant Adenoviruses Eric Campeau's Viral Vector Guide...Toth K. Adenovirus vectors for gene therapy, vaccination and cancer gene therapy. Curr Gene Ther. 2013...

...9N7polA (CT) 9 degrees N-7 DNA Polymerase chain terminating 165511 pOpen-K12polLF DNA Polymerase I, Large...methyltransferase 165520 pOpen-T4 PNK T4 PNK polynucleotide kinase 165521 pOpen-lambda red operon lambda red operon...pOpen-BovDNTT Bovine DNTT 165555 pOpen-ALPI CIP (calf intestinal phosphatase) Return to top Additional Resources...

... found on this page: SARS-CoV-2 Antibodies : Recombinant monoclonal antibodies that target SARS-CoV-2 ... Nucleocapsid Protein [mBG17] - Clone mBG17, recombinant mouse monoclonal antibody targeting the SARS-... Nucleocapsid Protein [mBG86] - Clone mBG86, recombinant mouse monoclonal antibody targeting the SARS-...

... catalyze cytidine deamination instead of (or in addition to) adenosine deamination, producing cytosine...Plasmids: CRISPR transposases CRISPR Recombinases and Integrases Recombinases, and their subfamily integrases...interesting adaptive immune response that detects and eliminates foreign DNA, which scientists have modified for...target sequence present in the gRNA. CRISPR was originally employed to knock out target genes in various...SpCas9, has one active nuclease domain and one inactivated one, allowing it to generate DNA nicks by cutting...cutting only one strand. Catalytically inactive “dead” Cas9 (dCas9) contains mutations in both nuclease...backbone HypaCas9 - increase Cas9 proofreading and discrimination evoCas9 - decrease off-target effects xCas9...

...guanosine. RNA editors : Cas13 fused to the ADAR2 deaminase convert adenosine to inosine on RNA. Inosine is..., Davidson AR. 2013. Bacteriophage genes that inactivate the CRISPR/Cas bacterial immune system. Nature...Cell . 154(2):442-51. PMID: 23849981 Ishino Y, Shinagawa H, Makino K, Amemura M, Nakata A. 1987. Nucleotide...

... codon combinations each amino acid is encoded for by multiple codons. Plasmids and Recombinant DNA Technology...field of recombinant DNA, in which many identical DNA fragments can be generated. The combination of a DNA...chromosomes, which are composed of DNA. These findings culminated in the central dogma of molecular biology, that...This obstacle has been overcome by the field of recombinant DNA technology, which enables the preparation... reference to any extrachromosomal heritable determinant. Plasmids are fragments of double-stranded DNA...a plasmid or vector DNA backbone generates a recombinant DNA molecule, which can be used to study DNA ...fragments of interest, such as genes. Creation of recombinant DNA Molecular Cloning Plasmids that are used ...

...Stitching Molecular cloning or the creation of recombinant DNA is an essential process used in scientific... most popular cloning methods used to create recombinant DNA. Restriction Enzyme Cloning Restriction enzyme... Restriction cloning ) Back to Top Gateway® Recombination Cloning Gateway cloning (Image from Plasmid ...101: Gateway Cloning ) Gateway® cloning is a recombination based cloning method. The benefit of Gateway...one plasmid into another is done via a single recombination reaction, drastically simplifying the process...plasmid must already be surrounded by specific recombination sites (in this regard, not so dissimilar from...rapidly shuttled into any compatible Gateway® Destination vector, which contain attR sites via LR clonase...

...insert to recombine with the destination vector (in this case the destination vector would be the lentiviral...interest. The transgene sequence is flanked by long terminal repeat (LTR) sequences, which facilitate integration...deletion in the 3'LTR, rendering the virus “self-inactivating” (SIN) after integration. Packaging plasmid(...addition of one additional plasmid. Second, Tat is eliminated from the 3rd generation system through the addition... always SIN: Uses 4 plasmids instead of 3 and eliminates the requirement for Tat. LTR Viral Promoter Wild...used to transduce the cells of interest. For determination of viral titer and full details, see the (Link...producing my lentiviral plasmids? Due to the long terminal repeats found in lentiviral plasmids, we recommend...

...in a higher background of non-recombinant adenoviral plasmids. Recombinant adenoviral plasmids are then... other patterns of recombination have not occurred. Once verified, the recombinant plasmid is linearized...transcripts. At either end of the genome are i nverted t erminal r epeats (ITRs). Genes are divided into early (...Coxsackie-Adenovirus Receptor (CAR) to enter cells. Recombinant adenovirus has two genes deleted: E1 and E3. ...left and right arms to facilitate homologous recombination of the transgene into the adenoviral plasmid...right homology arms which facilitate homologous recombination of the transgene into the adenoviral plasmid...single-stranded DNA parvovirus and was discovered as a contaminant of adenovirus preparations, whereas adenoviruses...

...Antibodies produced this way are called recombinant antibodies. Recombinant antibodies are created by cloning... time and labor intensive. Recombinant expression validation A recombinant expression strategy is used...cultured immune cells, or through the use of recombinant plasmids. Animals - Antibodies produced in animals... of a single antibody with little variation. Recombinant plasmids - Antibodies can be produced from plasmids... and can either be used while suspended in the original media or isolated and placed in a buffer. Antibody... binding site. This process, known as V(D)J recombination, allows for a wide variety of antibodies to ...abundant isotype in blood, also found in tissues; predominant isotype in secondary immune response Monomer ...

... BL 2012. Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression...delay the closing of the channel 470(activ.), 590(inact.) ReaChR Red-activatable variant of CrChR2 590 Channelrhodopsins...chloride pump from Haloarcula (Halobacterium) salinarum (strain Shark), used to silence neuronal activity...short or long periods of neuronal activation/inactivation periods. These can range from msec (hChR2) to...expression of the opsin and the area that is being illuminated. There are several different ways to control ...especially powerful when combined with site specific recombinase technology like Cre-lox, which allows you to ...one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half to CIB1,...

... Rep and Cap, flanked by two 145 base inverted terminal repeats (ITRs). These ITRs base pair to allow ...is necessary for lytic cycle activation. When recombinant AAV (rAAV) is used for research purposes, the...the Rep protein is supplied in trans , eliminating the ability of rAAV to integrate into its preferred ...AAV8 Photoreceptor Cells AAV2, AAV5, AAV8 RPE (Retinal Pigment Epithelium) AAV1, AAV2, AAV4, AAV5, AAV8...spontaneously annealing, upon infection, which eliminates the requirement for host cell DNA synthesis. ...increasing packaging capacity depends on homologous recombination. In this method, a gene is divided between two...sequence overlap. Co-expression induces homologous recombination and expression of the full-length transgene ...

...T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator, reverse primer Tac promoter ...GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC ...TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT...primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1 GCGTGAATGTAAGCGTGAC (Invitrogen...Invitrogen) CYC1 transcription termination signal, reverse primer DsRed1-C AGCTGGACATCACCTCCCACAACG (BD... GTGGTTTGTCCAAACTCATC (Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC ...

...Overview of Addgene's ready-to-use monoclonal recombinant antibody collection. These affinity reagents ... Antibodies Addgene distributes ready-to-use recombinant antibodies to help facilitate scientific research...

...assembly are different among the three methods, the final products are the same). All expression vectors listed...Sander et al., Nat Biotechnol. 2011 ): ID Plasmid C-terminal 0.5 TALE repeat Binds 32285 JDS70 NI RVD A 32287...

...Catalytically inactive CRISPR plasmids for purification of target loci.... molecule-mediated ChIP) system, catalytically inactive dCas9 is used to purify genomic DNA bound by the...