We narrowed to 850 results for: met
-
TypeCollection...serves the needs of many researchers, scientists sometimes require preps beyond our current in-stock capabilities... contributing your AAV vector experience, from methods to troubleshooting insights, you make research ...goes unshared, bridging the gap between published methods and real-world troubleshooting. Eligible Plasmids...
-
Validated gRNA Sequences
TypeCollection...25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC 61514 nick S. pyogenes 25569111 Hanna Mettl14 M. musculus...BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation S. pyogenes 26969735 Zoldoš Non-targeting H. .... sapiens GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection...mutant adeno-associated viral vector. Hum Gene Ther Methods . Feb;25(1):72-82. PMID: 24191859 Ye, et al. 2015...Engineered AAV Capsids Improve Transduction and Volumetric Spread in the CNS. Mol Ther Nucleic Acids . Sep...by novel capsid-modified AAV6 vectors. Mol Ther Methods Clin Dev . Apr 13;3:16026. PMID: 27308302 AAV44.9... -
Zinc Finger Consortium Reagents
TypeCollection...Reagents - Engineer zinc finger arrays via OPEN method Modular Assembly Engineering Reagents - Engineer...Engineer zinc finger arrays via Modular Assembly method Nuclease Expression Vectors - Cloning vectors for expressing... -
Zinc Finger Consortium: Nuclease Expression Vectors
TypeCollection...heterodimeric FokI domain. ( Doyon et al., Nat Methods 2011 ) in mammalian cells or zebrafish as described... -
CRISPR Plasmids - Purify Genomic Loci
TypeCollection... to conventional methods for genomic purification, CRISPR-based purification methods are more straightforward... -
DNA Service - Cloning Grade DNA
TypeCollection...260/280 ratio has been determined by spectrophotometer. Other methods of quantification may yield slightly... -
Synthetic Biology - Overview
TypeCollection...reporter, and tagging vectors. Metabolism Browse plasmids related to metabolic pathways and auxiliary components... -
TALEN Guide
TypeCollection...with the recently developed Golden Gate cloning method to assemble “multiple DNA fragments in an ordered...: 21248753 . TALEs for the masses. Rusk N. Nat Methods 2011 Mar;8(3):197. Pubmed PMID: 21473016 . Move... -
COVID-19 Resources
TypeCollection... et al., 2008). TACE plasmids - (ADAM17) a metalloprotease that cleaves hACE2, potentially increasing ... mapping. Other Resources Protocols Coronavirus Method Development Community at Protocols.io (Link opens... -
Trimmer Lab NeuroMab Collection
TypeCollection...Anti-MMP9 matrix metalloproteinase-9 precursor [L51/82R] MMP9 matrix metalloproteinase-9 precursor Rat ...IgG2a 206552 Anti-Histone H4-dimethyl-Arg3 [N309A/21R] Histone H4-dimethyl-Arg3 Human Mouse IgG2a 206553...) Crosnier C, et al. 2010. A rapid and scalable method for selecting recombinant mouse monoclonal antibodies... -
Zhang Lab CRISPR Page
TypeCollection...NE, Shalem O, Zhang F. Nat Methods . 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047. PubMed . Return to ... -
Tetracycline Inducible Expression
TypeCollection...that respond to natural stimuli like hormones or metal ions, scientists have adapted an antibiotic resistance...promoter, and other tet- or dox-dependent promoters (sometimes generally called Ptet) have been designed by combining... -
Synthetic Biology - Strains
TypeCollection...Blog Genome Engineering Cloning & Genomic Tools Metabolism Networks & Gene Regulation Sensing & Signaling... -
Synthetic Biology - Sensing and Signaling
TypeCollection...Blog Genome Engineering Cloning & Genomic Tools Metabolism Networks & Gene Regulation Sensing & Signaling... -
Synthetic Biology - Networks and Gene Regulation
TypeCollection...Blog Genome Engineering Cloning & Genomic Tools Metabolism Networks & Gene Regulation Sensing & Signaling... -
Synthetic Biology - Cloning and Genomic Tools
TypeCollection...Blog Genome Engineering Cloning & Genomic Tools Metabolism Networks & Gene Regulation Sensing & Signaling... -
Antibodies
TypeCollection... by sharing our protocols and quality control methods. Learn More Guide New to using antibodies? In our... -
KLF Research Plasmids
TypeCollection...proliferation, differentiation, inflammation, metabolism, fibrosis, atherosclerosis, and carcinogenesis... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...hybridization (FISH), CRISPR imaging offers a unique method for detecting the chromatin dynamics in living ...