...mutant adeno-associated viral vector. Hum Gene Ther Methods . Feb;25(1):72-82. PMID: 24191859 Ye, et al. 2015...Engineered AAV Capsids Improve Transduction and Volumetric Spread in the CNS. Mol Ther Nucleic Acids . Sep...by novel capsid-modified AAV6 vectors. Mol Ther Methods Clin Dev . Apr 13;3:16026. PMID: 27308302 AAV44.9...

...25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC 61514 nick S. pyogenes 25569111 Hanna Mettl14 M. musculus...BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation S. pyogenes 26969735 Zoldoš Non-targeting H. .... sapiens GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT...

...Reagents - Engineer zinc finger arrays via OPEN method Modular Assembly Engineering Reagents - Engineer...Engineer zinc finger arrays via Modular Assembly method Nuclease Expression Vectors - Cloning vectors for expressing...

...benthamiana . Please refer to the Supplementary methods section of the manuscript for the protocol on assembling...Chaparro-Garcia A, Kamoun S, Nekrasov V. Plant Methods . 2013 Oct 11;9(1):39. PubMed PMID 24112467 . Individual...

...heterodimeric FokI domain. ( Doyon et al., Nat Methods 2011 ) in mammalian cells or zebrafish as described...

... to conventional methods for genomic purification, CRISPR-based purification methods are more straightforward...

...isolate a given genomic locus. Tag Various CRISPR methods are available to endogenously tag your gene of ...of interest. Visualize CRISPR fluorescence methods can be used to visualize genomic loci. dCas9-FokI dCas9...

...260/280 ratio has been determined by spectrophotometer. Other methods of quantification may yield slightly...

...Anti-MMP9 matrix metalloproteinase-9 precursor [L51/82R] MMP9 matrix metalloproteinase-9 precursor Rat ...IgG2a 206552 Anti-Histone H4-dimethyl-Arg3 [N309A/21R] Histone H4-dimethyl-Arg3 Human Mouse IgG2a 206553...) Crosnier C, et al. 2010. A rapid and scalable method for selecting recombinant mouse monoclonal antibodies...

...reporter, and tagging vectors. Metabolism Browse plasmids related to metabolic pathways and auxiliary components...

... editing is a “search and replace” gene editing method in which Moloney Murine Leukemia Virus Reverse ... to optimize and improve the efficiency of this method. In the PE2 system, five mutations were introduced...

...with the recently developed Golden Gate cloning method to assemble “multiple DNA fragments in an ordered...: 21248753 . TALEs for the masses. Rusk N. Nat Methods 2011 Mar;8(3):197. Pubmed PMID: 21473016 . Move...

...MK, NEGF2 MET met proto-oncogene (hepatocyte growth factor receptor) AUTS9, HGFR, RCCP2, c-Met MIA melanoma... SDGF ARMET arginine-rich, mutated in early stage tumors ARP, MANF, MGC142148, MGC142150 ARMETL1 arginine-rich...

...NE, Shalem O, Zhang F. Nat Methods . 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047. PubMed . Return to ...

...-hCMV-GFPcre tet inducible Cre-GFP fusion, metallothionein MT-I region including the polyadenylation site...levels mutant TEF1 Yeast Piper 60933 pPL5628_TEF1*-Cre_MET15 Cre expressed at low levels mutant TEF3 Yeast ...

...UUG, CUU, CUC, CUA, CUG Lysine Lys K AAA, AAG Methionine Met M AUG Phenylalanine Phe F UUU, UUC Proline ...To learn more about different types of cloning methods check out our guide on molecular cloning techniques...developed the process termed Sanger sequencing, sometimes referred to as chain-termination sequencing or... making it an efficient and reliable sequencing method. Next Generation Sequencing Although Sanger sequencing... 5 factors to help you choose the right cloning method Plasmids 101: Restriction Cloning Plasmids 101:...

...Blog Genome Engineering Cloning & Genomic Tools Metabolism Networks & Gene Regulation Sensing & Signaling...

...Blog Genome Engineering Cloning & Genomic Tools Metabolism Networks & Gene Regulation Sensing & Signaling...

... GFP have long been used for labeling, but new methods are emerging to use these fluorescent proteins ...

...Blog Genome Engineering Cloning & Genomic Tools Metabolism Networks & Gene Regulation Sensing & Signaling...