Skip to main content

We narrowed to 12 results for: beta-actin;

Showing: 1 - 12 of 12 results
  1. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ...ubiquitous. human beta actin General expression mRNA Mammalian promoter from beta actin gene Constitutive...  Contains CMV enhancer, chicken beta actin promoter, and rabbit beta-globin splice acceptor. TRE General...expression mRNA Strong insect promoter from Drosophila Actin 5c gene Constitutive  Commonly used in expression...
  2. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...filaments beta-Actin mClover3 Michael Lin 74255 pKanCMV-mRuby3-18aa-actin Actin filaments beta-Actin mRuby3...Patricia Wadsworth 27123 eTC GFP beta-actin full length Actin filaments beta-Actin EGFP Robert Singer 40908 pDEST...LIfeAct-mCherry-N1 Actin filaments LifeAct mCherry Robin Shaw 21948 pCAG-mGFP-Actin Actin filaments beta-Actin EGFP ...pCMV-mGold2t-Actin-C-18 Actin filaments beta-Actin mGold2t Francois St-Pierre 231772 pCMV-mGold2s-Actin-C-18 ...18 Actin filaments beta-Actin mGold2s Francois St-Pierre 74259 pKanCMV-mClover3-18aa-actin Actin filaments...Vladislav Verkhusha 31949 pPAmCherry-b-actin Actin filaments beta-Actin PAmCherry Vladislav Verkhusha 79990...-actinin 1 Actin filaments alpha-Actinin 1 EGFP Carol Otey 27676 Cortactin-pmCherryC1 Actin filaments ...
  3. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...73039 Expresses Nluc and copGFP from the chicken beta-actin CMV enhancer pCDH-PGK-Nluc-P2A-copGFP-T2A-Puro...promoter while pICPIS-CB contains the Chicken-beta actin promoter with CMV enhancer. pAdx-CMV-LacZ (Addgene...pICPIS-CB 73356 AdenoX shuttle vector with chicken-beta actin CMV enhancer promoter SV40 polyA Addgene Resources...
  4. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...AICSDP-15 mEGFP Beta-actin Actin filaments 87426 SEC61B-mEGFP AICSDP-7 mEGFP Sec61 beta Endoplasmic reticulum...1-J Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin Adherens junctions 107579 RAB5A-mEGFP AICSDP...
  5. An Integrin Antibody Toolkit from IPI

    Type
    Blog Post
    ...Anti-Integrin alpha 5 beta 1 [IPI-ITGA5/ITGB1.2] Integrin alpha-5,Integrin beta-1 Human, Mouse IgG1 Rabbit...Anti-Integrin alpha 5 beta 1 [IPI-ITGA5/ITGB1.4] Integrin alpha-5,Integrin beta-1 Human, Mouse IgG1 Rabbit...Anti-Integrin alpha V beta 8 [IPI-ITGAV/ITGB8.1] Integrin alpha-V,Integrin beta-8 Human IgG1 Rabbit ...Anti-Integrin alpha V beta 8 [IPI-ITGAV/ITGB8.8] Integrin alpha-V,Integrin beta-8 Human IgG1 Rabbit ...Anti-Integrin alpha V beta 6 [IPI-ITGAV/ITGB6.2] Integrin alpha-V,Integrin beta-6 Human, Mouse IgG1 Rabbit...Anti-Integrin alpha V beta 6 [IPI-ITGAV/ITGB6.3] Integrin alpha-V,Integrin beta-6 Human, Mouse IgG1 Rabbit...Anti-Integrin alpha V beta 6 [IPI-ITGAV/ITGB6.4] Integrin alpha-V,Integrin beta-6 Human, Mouse IgG1 Rabbit...
  6. Promoters

    Type
    Guide
    ...contains CMV early enhancer element and the chicken beta-actin promoter CMV Constitutive Mammalian Strong promoter...Constitutive Insect Strong promoter from Drosophila actin 5c gene Gal4/UAS Specific Insect Requires UAS regulatory...
  7. Fluorescent Proteins 101: GFP Fusion Proteins - Making the Right Connection

    Type
    Blog Post
    ... GFP and its homologues have a beta-barrel structure. Although the beta barrel has no strong affinity ...insertion is a loop in between secondary structure (beta-sheets or alpha helices). An additional requirement...polarization independent of GDI-mediated extraction and actin-based trafficking." PLoS biology 13.4 (2015): e1002097...
  8. Sequencing Primers

    Type
    Guide
    ...CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit beta-globin intron...promoter Forward AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC...intron Reverse Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC... site Reverse pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F...of WPRE Reverse XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin 3'UTR Reverse XEF1a TTTCGCCCTAACTTCGTGAT ...
Showing: 1 - 12 of 12 results