Skip to main content

We narrowed to 20 results for: beta-actin;

Showing: 1 - 20 of 20 results
  1. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ...ubiquitous. human beta actin General expression mRNA Mammalian promoter from beta actin gene Constitutive...  Contains CMV enhancer, chicken beta actin promoter, and rabbit beta-globin splice acceptor. TRE General...expression mRNA Strong insect promoter from Drosophila Actin 5c gene Constitutive  Commonly used in expression...
  2. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...18aa-actin Actin filaments beta-Actin mClover3 Michael Lin 74255 pKanCMV-mRuby3-18aa-actin Actin filaments...Patricia Wadsworth 27123 eTC GFP beta-actin full length Actin filaments beta-Actin EGFP Robert Singer 40908 pDEST...LIfeAct-mCherry-N1 Actin filaments LifeAct mCherry Robin Shaw 21948 pCAG-mGFP-Actin Actin filaments beta-Actin EGFP ...filaments beta-Actin mGold2t Francois St-Pierre 231772 pCMV-mGold2s-Actin-C-18 Actin filaments beta-Actin ...Vladislav Verkhusha 31949 pPAmCherry-b-actin Actin filaments beta-Actin PAmCherry Vladislav Verkhusha 79990...filaments beta-Actin mRuby3 Michael Lin 189767 pLifeAct-mScarlet3_N1 Actin filaments LifeAct mScarlet3 Dorus...alpha-actinin 1 Actin filaments alpha-Actinin 1 EGFP Carol Otey 27676 Cortactin-pmCherryC1 Actin filaments...
  3. An Integrin Antibody Toolkit from IPI

    Type
    Blog Post
    ...Anti-Integrin alpha 5 beta 1 [IPI-ITGA5/ITGB1.2] Integrin alpha-5,Integrin beta-1 Human, Mouse IgG1 Rabbit...Anti-Integrin alpha 5 beta 1 [IPI-ITGA5/ITGB1.4] Integrin alpha-5,Integrin beta-1 Human, Mouse IgG1 Rabbit...Anti-Integrin alpha V beta 8 [IPI-ITGAV/ITGB8.1] Integrin alpha-V,Integrin beta-8 Human IgG1 Rabbit ...Anti-Integrin alpha V beta 8 [IPI-ITGAV/ITGB8.8] Integrin alpha-V,Integrin beta-8 Human IgG1 Rabbit ...Anti-Integrin alpha V beta 6 [IPI-ITGAV/ITGB6.2] Integrin alpha-V,Integrin beta-6 Human, Mouse IgG1 Rabbit...Anti-Integrin alpha V beta 6 [IPI-ITGAV/ITGB6.3] Integrin alpha-V,Integrin beta-6 Human, Mouse IgG1 Rabbit...Anti-Integrin alpha V beta 6 [IPI-ITGAV/ITGB6.4] Integrin alpha-V,Integrin beta-6 Human, Mouse IgG1 Rabbit...
  4. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...73039 Expresses Nluc and copGFP from the chicken beta-actin CMV enhancer pCDH-PGK-Nluc-P2A-copGFP-T2A-Puro...promoter while pICPIS-CB contains the Chicken-beta actin promoter with CMV enhancer. pAdx-CMV-LacZ (Addgene...pICPIS-CB 73356 AdenoX shuttle vector with chicken-beta actin CMV enhancer promoter SV40 polyA Addgene Resources...
  5. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...AICSDP-15 mEGFP Beta-actin Actin filaments 87426 SEC61B-mEGFP AICSDP-7 mEGFP Sec61 beta Endoplasmic reticulum...1-J Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin Adherens junctions 107579 RAB5A-mEGFP AICSDP...Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks 124608 NPM1-mTagRFP-T AICSDP...
  6. Fluorescent Proteins 101: GFP Fusion Proteins - Making the Right Connection

    Type
    Blog Post
    ... GFP and its homologues have a beta-barrel structure. Although the beta barrel has no strong affinity ...insertion is a loop in between secondary structure (beta-sheets or alpha helices). An additional requirement...polarization independent of GDI-mediated extraction and actin-based trafficking." PLoS biology 13.4 (2015): e1002097...
  7. Sequencing Primers

    Type
    Guide
    ...CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit beta-globin intron...promoter Forward AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC...intron Reverse Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC... site Reverse pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F...of WPRE Reverse XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin 3'UTR Reverse XEF1a TTTCGCCCTAACTTCGTGAT ...
  8. Simplify Cloning with in vivo Assembly

    Type
    Blog Post
    ...encoding plasmids, or promoters such as the chicken beta-actin promoter of the pHLsec vector. In this scenario...amplify by PCR, so we usually add DMSO (3%) and Betaine (1 M) to the PCR mix. When PCR is not possible ...
  9. Multiplexed Capture of Promoter-enhancer 3D Chromatin Structures Using CRISPR

    Type
    Blog Post
    ...interactions at a promoter in the well-characterized beta globin locus. The two methods had similar rates ...interactions at five sites in the well-characterized beta-globin locus were analyzed with CAPTURE 2.0, with...can tell you things like which enhancers are interacting with which promoters, what part of a gene enhancers...how many promoters or genes each enhancer is interacting with. Super enhancers are particularly good models...
  10. Promoters

    Type
    Guide
    ...contains CMV early enhancer element and the chicken beta-actin promoter CMV Constitutive Mammalian Strong promoter...Constitutive Insect Strong promoter from Drosophila actin 5c gene Gal4/UAS Specific Insect Requires UAS regulatory...
  11. Immunology Research Plasmids and Resources

    Type
    Collection
    ...inhibin, beta A EDF, FRP INHBB inhibin, beta B MGC157939 INHBC inhibin, beta C IHBC INHBE inhibin, beta E MGC4638...regulatory subunit B, beta isoform PPP3RL PRKCB protein kinase C, beta MGC41878, PKC-beta, PKCB, PRKCB1, PRKCB2...gonadotropin, beta polypeptide 7 CG-beta-a, FLJ35403, FLJ43118 CGB8 chorionic gonadotropin, beta polypeptide...Era, NR3A1 ESR2 estrogen receptor 2 (ER beta) ER-BETA, ESR-BETA, ESRB, ESTRB, Erb, NR3A2 ESRRA estrogen-related...factor, beta 1 CED, DPD1, TGFB, TGFbeta TGFB2 transforming growth factor, beta 2 MGC116892, TGF-beta2 TGFB3...catalytic, beta polypeptide DKFZp779K1237, MGC133043, PI3K, PI3KCB, PI3Kbeta, PIK3C1, p110-BETA PIK3CD phosphoinositide...
  12. Hot Plasmids: February 2026

    Type
    Blog Post
    ...NRXNb family member and labeled with Anti-Neurexin-3-beta [IPI-NRXN3b.31] (Addgene #237812). Each graph depicts...the mean fluorescence intensity of Anti-Neurexin-3-beta labeling for imaged cells. Image from Morano A, ...works through a fusion of an endogenous vault-interacting (INT) domain and Poly-A binding protein, allowing...
  13. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Mouse IgG2a 114530 Anti-Neurexin-1-Beta [N170A/1.1R] Neurexin-1-Beta Human Mouse IgG2a 114533 Anti-Laforin...Mouse IgG2a 188207 Anti-Neurexin-1-Beta [N170A/26R] Neurexin-1-Beta Human Mouse IgG2a 188208 Anti-FGF13... 206659 Anti-Neurexin-1-Beta [N170A/1R-2b] Neurexin-1-Beta (staining) Human Mouse IgG2b 206660 Anti-Cav3.1...Mouse IgG1 206702 Anti-Neurexin-1-Beta [N170A/1R-1] Neurexin-1-Beta Human Mouse IgG1 206703 Anti-GFAP ...C-terminus Human Mouse IgG2a 220412 Beta-2 adrenergic receptor [N430/30R] Beta-2 adrenergic receptor Mouse Mouse...227063 Neurexin-1-Beta (Homo sapiens) recombinant mouse monoclonal antibody. Neurexin-1-Beta Human Chimera...Mouse Mouse 190534 Neurexin-1-Beta scFv [N170A/1] N170A/1 scFv Neurexin-1-Beta Human Mouse 190535 PSD-93/...
  14. p53 Pathway

    Type
    Collection
    ...GADD45G Growth arrest and DNA-damage-inducible; alpha, beta, or gamma IGF-BP3 Insulin-like growth factor binding...inhibitor 1 Bax BCL2-associated X protein Bid BH3 interacting domain death agonist CASP3 Caspase 3, apoptosis-related...
  15. Ras Pathway

    Type
    Collection
    ...Catalytic subunit alpha B1,B2: non-catalytic subunit beta G1, G2, G3: non-catalytic subunit gamma PTEN Phosphatase...PIN1 Peptidylprolyl cis/trans isomerase, NIMA-interacting 1 PLXNB1 Plexin B1 PPP1CA Protein phosphatase...
  16. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Hyman 89483 VN-beta Synuclein SNCB Venus CMV Lewy body dementia Tiago Outeiro 89484 beta Synuclein-VC SNCB...Dreyfuss 71875 pET-Sac-Abeta(M1-42) APP T7 Alzheimer's Dominic Walsh 71876 pET-Sac-Abeta(M1-40) APP T7 Alzheimer's...Beutler 127151 pET-Sac-Abeta(MC1-42) APP T7 Alzheimer's James Nowick 127152 pET-Sac-Abeta(MC1-40) APP T7 Alzheimer's...pUCIDT-attL1-Human ABeta-attR5 APP Alzheimer's Nicholas Tolwinski 160437 pUCIDT-attL1-Worm ABeta-attR5 APP Cleavage...Parkinson's Hilal Lashuel 105970 hsp70: mKate2 dynactin1-811 DCTN1 mKate2 hsp70 ALS, motor neuron disease...disease Caren Norden 105971 pME mKate2-dynactin1-811 DCTN1 mKate2 ALS, motor neuron disease Caren Norden ...115182 pLD-puro-Cc-PARK7WT-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115183 pLD-puro-Cc-PARK7V51G-VA...
  17. MAPK Plasmids

    Type
    Collection
    ...p54bSAPK MAPK11 P38B, P38BETA2, PRKM11, SAPK2, SAPK2B, p38-2, p38Beta MAPK12 ERK3, ERK6...kinases. They regulate diverse cellular programs by acting as an integration point for multiple biochemical...JNK2A, JNK2ALPHA, JNK2B, JNK2BETA, PRKM9, SAPK, SAPK1a,...
Showing: 1 - 20 of 20 results