We narrowed to 22 results for: THY-2
-
TypeCollection...immunoglobulin heavy diversity 2-15 D2, IGHD215 IGHD2-2 immunoglobulin heavy diversity 2-2 IGHD22 IGHD2-21 immunoglobulin...heat shock 70kDa protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, ...variable 2-33 (non-functional) IGLV233, V1-9 IGLV2-8 immunoglobulin lambda variable 2-8 IGLV28, V1-2 IGLV3...beta 4 DEFB-2, DEFB102, DEFB2, HBD-2, SAP1 EDN1 endothelin 1 ET1, HDLCQ7 EDN2 endothelin 2 ET2, PPET2 ...receptor subfamily 2, group C, member 1 TR2 NR2C2 nuclear receptor subfamily 2, group C, member 2 TAK1, TR2R1...suppression of tumorigenicity 2 - STC1 stanniocalcin 1 STC STC2 stanniocalcin 2 STC-2, STCRP TAC1 tachykinin,...PTHR1 PTH2 parathyroid hormone 2 TIP39 PTH2R parathyroid hormone 2 receptor PTHR2 PTHLH parathyroid hormone-like...
-
COVID-19 Resources
TypeCollection...page: SARS-CoV-2 Antibodies : Recombinant monoclonal antibodies that target SARS-CoV-2 nucleocapsid protein...protein. SARS-CoV-2 Plasmids : Plasmids that are available or coming soon containing SARS-CoV-2 sequences. SARS-CoV... targeting the SARS-CoV-2 nucleocapsid protein (Brian Geiss). Anti-SARS-CoV-2 Nucleocapsid Protein [mBG86...targeting the SARS-CoV-2 nucleocapsid protein (Brian Geiss). Plasmids SARS-CoV-2 Plasmids Many plasmids...SARS-CoV-2 plasmids are curated on a separate Ginkgo Bioworks Plasmid Collection page. SARS-CoV-2 Pooled...Converting Enzyme 2) is the host cell receptor mediating the entry of SARS-CoV and SARS-CoV-2 viruses. ( 1 ...that primes the SARS-CoV-2 S protein and is involved in virus entry into cells. ( 2 ) FURIN - an enzyme that... -
Trimmer Lab NeuroMab Collection
TypeCollection...FHF2 Human Mouse IgG2a 114527 Anti-JIP-2/IB-2 [N135/37.2R] JIP-2/IB-2 Mouse Mouse IgG2a 114529 Anti-Pan-SAPAP...Anti-CDY1/2/L1/L2 [N143/36R] CDY1/2/L1/L2 Human Mouse IgG2a 206535 Anti-CDY1/2 [N143/38R] CDY1/2 Human Mouse...206763 Neuroligin-2 scFv [L107/90] L107/90 scFv Neuroligin-2 Mouse Mouse 206764 Neuroligin-2 scFv [L107/95...receptor Rat Mouse IgG2a 114484 Anti-Stonin-2 [N346/9R] Stonin-2 Human Mouse IgG2a 114485 Anti-NSD3 [N348...Pan-FHF-A Human Mouse IgG2a 114510 Anti-REEP1/2 [N326D/29R] REEP1/2 Mouse Mouse IgG2a 114511 Anti-Kv3.1b K+ ...Mouse Mouse IgG2a 114547 Anti-Mitofusin-2 [N171/17.4R] Mitofusin-2 Mouse Mouse IgG2a 114548 Anti-Mortalin...Mouse IgG2a 140065 Anti-SCG10/Stathmin-2 [L5/1R] SCG10/Stathmin-2 Rat Mouse IgG2a 140066 Anti-Co-Rest/RCOR1... -
Ras Pathway
TypeCollection...Neurofibromin 1 NFE2L2 Nuclear factor, erythroid 2 like 2 NFKB1 Nuclear factor of kappa light polypeptide...factor receptor bound protein 2 ICMT Isoprenylcysteine carboxyl methyltransferase INSR Insulin receptor INSRR...ARHGEF2 Rho/Rac guanine nucleotide exchange factor 2 CCND CCND1 CCND2 CCND3 Cyclin D CDK CDK4 CDK6 Cyclin-dependent...enhancer of kinase suppressor of Ras CYTH2 Cytohesin 2 DUSP DUSP1 DUSP2 DUSP3 DUSP4 DUSP5 DUSP6 Dual specificity...transcription factor ECT2 Epithelial cell transforming 2 EGFR Epidermal growth factor receptor EIF4EBP EIF4EBP1...binding protein ERBB2 Erb-b2 receptor tyrosine kinase 2 ERK MAPK1 MAPK3 Also known as MAPK; Mitogen-activated...3,4,5-trisphosphate-dependent Rac exchange factor 2 PRKA PRKAA1 PRKAA2 PRKAB1 PRKAB2 PRKAG1 PRKAG2 PRKAG3... -
Fluorescent Protein Guide: Biosensors
TypeCollection...of basal H 2 O 2 levels with peroxiredoxin-based probes Real-time monitoring of basal H 2 O 2 levels with...Belousov Hydrogen Peroxide (H 2 O 2 ) Cytosolic or mitochondrial sensor for H 2 O 2 oxidation (roGFP2-Orp1) ...peroxiredoxin-2-based probe. Nat Commun. 2018 Aug 7;9(1):3145. Hadley Sikes Hydrogen Peroxide (H 2 O 2 ) Monitoring...encoded Ca(2+) indicator with enhanced two-photon absorption. Neurophotonics. 2024 Apr;11(2):024207. doi...Calcium Red fluorescent calcium sensors (fRCaMP1/2, GECO1/2) The kinetic mechanisms of fast-decay red-fluorescent...intracellular Zn(2+) homeostasis. Nat Methods. 2009 Oct;6(10):737-40. Maarten Merkx Zinc eZinCh-2 Zn2+ FRET ... eZinCh-2: A Versatile, Genetically Encoded FRET Sensor for Cytosolic and Intraorganelle Zn(2+) Imaging... -
Genetic Code Expansion
TypeCollection...48696 pANAP AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian TAG Peter...Mammalian TAG Huiwang Ai 73544 pEvol-pAcFRS.2.t1 pAcFRS.2.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial...Bacterial TAG Farren Isaacs 73546 pEvol-pAzFRS.2.t1 pAzFRS.2.t1 E. coli p-azido-l-phenylalanine (pAzF) Bacterial..._AnapRS AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian TAG Simon...Jesse Rinehart 71403 pCMV-DnpK PylRS M. barkeri N6‐(2‐(2,4‐dinitrophenyl)acetyl)lysine (DnpK) Bacterial,...pDule-IBBN (G2) IBBN (G2) synthetase M. jannaschii 4-(2′-bromoisobutyramido)-phenylalanine (IBBN) and structurally...pDule2-IBBN (G2) IBBN (G2) synthetase M. jannaschii 4-(2′-bromoisobutyramido)-phenylalanine (IBBN) and structurally... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TGGTGGCGCAGCAGAGGGagctgatccaggaccaGGCCACCGTGAACATCA DLK1 (site #2) TAL3422 & TAL3423 TGAGGTACAGGCAGCTGGtggcgcagcagagggagcTGATCCAGGACCAGGCCA...TGGAAGACCCGTTGGAGAaagagatcccaccaacTGAAATAAAAGATTCAGA hemogen (site #2) TAL3276 & TAL3277 TGATTTGTTTGTTTGCTaggaggaattcggcggCGACTCAGAGACAGAGA...TGTTTCAGCAGAGCCCCGctgaagagctccccatGGAGATGGAAGGAGTGGA hif1al (site #2) TAL3280 & TAL3281 TGCCCTCAGGACTTCTGCacgcctgaactccgcaAGCTTCTGTCTCCAATA...TGGAGCAGGGTGCGAGTGtgtctgagctgaaggaGGCGGTGGGTCGTTTACA park2 (site #2) TAL3334 & TAL3335 TGATCGTTTTCGTGCGGTttaattccagccatggGTTCCCGGTGGAGTTGGA...TGTTAAGGCTCTGTATAGcagtgtgtgtcctggcCACTTGCTGGGCTCAGGA retinitis pigmentosa 2 (X-linked recessive) TAL3526 & TAL3527 TCTTTTTGTGCTGCGCCAcccagcccataatcgaGTCTTCTACAGGCATGAA...TGGAAACCGAGCTGAAGCccccggcgccccagcccaACACCGGGGGCACGGGGA Sox2 (site #2) TAL3368 & TAL3369 TGGTGGGGTAGACTTTCGagaaaatcggtttaaaTGTATAACATGATGGAAA...TGCTTTCACGCATTGCACtacacattggcaagatgGCAGCCACCATCGGGAGA prothymosin alpha a TAL3344 & TAL3345 TTATCATTCGCATCTCGTatttctctttatattaTTTTATTCCGAGACCCCA... -
Rett Syndrome
TypeCollection...disease-causing mutations in the gene methyl-CpG binding protein 2 ( MECP2 ). MECP2 Rett syndrome is an...mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet . 23, 185–188. (Link opens...PMID: 16905679 Cuddapah et al. 2014. Methyl-CpG-binding protein 2 (MECP2) mutation type is associated ...Neul et al. 2008. Specific mutations in methyl-CpG-binding protein 2 confer different severity in Rett syndrome...phenotypes of males with mutations in Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet...is not clear, however, the ability to bind to methylated DNA and recruit known co-repressors or other ...including: the N - t erminal D omain (NTD) the M ethyl B inding D omain (MBD) a T ranscriptional R epressor... -
Neurodegeneration Research Collection
TypeCollection...New and Noteworthy: Use tau constructs to study aggregation. Saha et al. Nat Commun. 2023 Feb 2. Study ...different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of individuals develop... rodent species. Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 ...with the iPSC toolbox . Lam et al. bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression...guide to using plasmid pooled libraries . New and Noteworthy: Use a CRISPRi system to target alpha-synuclein...system, vesicular brain cells and more. New and Noteworthy: AAV.rTH.PI.Cre.SV40 ready-to-use viral prep ...and fibroblasts into neurons and more. New and Noteworthy: Study aberrant axon initial segment (AIS) plasticity... -
Validated gRNA Sequences
TypeCollection...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation S. pyogenes 26969735 Zoldoš Non-targeting H. .... sapiens GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT...