Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 32 results for: tre promoter

Showing: 1 - 32 of 32 results

  1. Tetracycline Inducible Expression

    Type
    Collection
    ...unable to bind the TRE. In the presence of tetracycline, rtTA binds the TRE, promoting gene expression. ...and EGFP. Pbi contains a TRE between two minimal CMV promoters. None Pbi (TRE, miniCMV) Bert Vogelstein...Response Element (TRE) typically features seven copies of tet O upstream of a minimal CMV promoter, and other...introduced the TRE, placing seven copies of tet O upstream of the minimal CMV promoter. In the absence...may also like... Blog: Inducible Promoters Blog: Repressible Promoters Mammalian shRNA Plasmids Collection... of tetracycline, tTA binds to the TRE and its VP16 domain promotes gene expression. In the presence of...fold induction of the gene of interest. Tight TRE promoter or P Tight : reduced background expression and...

  2. Cre-lox system

    Type
    Collection
    ...Stainier 85040 pK170.AAV-TRE-Cre-WPRE (Supernova) TRE-Cre based Supernova TRE AAV Iwasato 85577 pTC-...system is tight temporal regulation. Promoter-regulated Cre: The promoter region defines the areas in which...active promoter like CAG, or expressed only in a subset of cells under a more specific promoter (e.g. ... PBAD promoter Bacterial Richmond 112614 pVHC Venus and Cre-ERT2 with MCS for inserting promoter none ...inserting promoter none Mammalian Heller 112616 pmTHC TFP and Cre-ERT2 with MCS for inserting promoter none...GFP and Cre CMV Lentiviral Lu 118029 pAAV-TRE-dDIO-vCre VCre TRE AAV Luo 119063 pBac(3xP3-gTc’v; Tc-hsp68...CAG Mammalian Zhang 68477 pTRE:iRFP670-EFS:Cre-2A-GFP iRFP670, Cre, and GFP TRE Mammalian Jacks 68544 AAV-Cre-GFP...

  3. Luciferase Plasmid Collection

    Type
    Collection
    ...of 5' promoter/enhancer regions Joshua Mendell 60323 pGL4.23-GW Firefly Insertion of 5' promoter/enhancer... reporter vector. Insertion of 5' promoter/enhancer regions upstream of Firefly luciferase. Renilla luciferase...tool for scientists. Regulatory elements such as promoters, enhancers and untranslated regions, or shRNA ...Jorge Ferrer 16539 pBV-Luc Firefly Insertion of 5' promoter/enhancer regions Bert Vogelstein 12178 pIS0 Firefly... Renilla luciferase under the control of a CMV promoter is present for normalization William Kaelin 71248...71248 pXPG Firefly Insertion of 5' promoter/enhancer regions. Mutations within the luciferase gene allow...

  4. AAV Molecular Tools

    Type
    Collection
    ...Gradinaru 99120 pAAV-ihSyn1-tTA Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator...pAAV-ihSyn1-DIO-tTA Cre-dependent and inducible Synapsin promoter (ihSyn) Cre-dependent expression of the tet-off...for amplified tTA expression. 1 Gradinaru 117383 TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible...

  5. Lentivirus Plasmids

    Type
    Collection
    ...shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible expression...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor...silencing were added; Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor...with a chimeric 5’LTR, Any expression cassette (promoter and gene of interest) can be cloned into the plasmid...coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP...41393 pCW57.1 3rd Inducible lentiviral expression, TRE-gateway; PGK-rtTA-2A-puro. See article for more versions...

  6. Brain Initiative Collection

    Type
    Collection
    ...fluorescent protein eYFP from the hSyn1 promoter Viviana Gradinaru 117383-AAV1 TRE-DIO-eYFP An AAV genome with tet-inducible...-mCherry Expression of hM4D(Gi) using the CD68 promoter. Bryan Roth 75033-AAV9 pAAV CD68-hM4D(Gi)-mCherry...mCherry Expression of hM4D(Gi) using the CD68 promoter. Bryan Roth 83894-AAV1 pAAV-hDlx-Flex-dTomato-Fishell...An AAV genome that expresses tTA from the hSyn1 promoter that contains a positive feedback loop for amplifed...Cre-dependent expression of the tTA from the hSyn1 promoter. Contains a positive feedback loop for amplifed...recombinase-dependent expression of mNeonGreen from the CAG promoter Viviana Gradinaru 100798-AAV1 pAAV-syn-FLEX-splitTVA-EGFP-tTA...expression of the fluorescent protein EYFP from the CAG promoter Viviana Gradinaru 104055-AAV2 pAAV-CAG-eYFP An...

  7. Bacterial Expression Systems

    Type
    Collection
    ...coli strain. Addgene Blog Inducible Promoters Repressible Promoters Synthetic Photobiology: Optogenetics...pRU1701 Promoter activity Fluorescence (GFP+) Gram-negative bacteria Philip Poole 14460 pOT2 Promoter activity...pCHERRY3 Promoter activity Fluorescence (mCherry) Mycobacterium sp. Tanya Parish 24657 pASTA3 Promoter activity...#1000000037) contains specific bacterial promoters that vary in strength and that can be used to reliably drive...periplasmic localization: PelB, MalE, OmpA ID Plasmid Promoter Tags PI Additional Addgene Protein Purification...Toolkit (Addgene #1000000080) features a library of promoters and purification tags compatible with Golden Gate...temperature, in different bacterial systems. ID Plasmid Promoter Inducer Expression Species PI 44249 pdCas9-bacteria...

  8. Plant Plasmids and Resources

    Type
    Collection
    ...containing promoters that drive general and species-specific gene expression (see the column ‘promoter’ in the...for, such as the promoter or cloning method of choice. ID Plasmid Description Promoter Cloning Method PI..., such as the promoter or fluorescent protein of choice. ID Plasmid Description Promoter PI Return to ...Synthetic Biology Research Centre (Link opens in a new window) - The initiative promotes interdisciplinary exchange... nucleases, base editors, gRNA backbones, and promoters for expression in monocots and dicots - Vladimir...modules for assembly of CRISPR/Cas9 constructs - Sylvestre Marillonnet and Johannes Stuttmann. Combined fluorescent...

  9. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Browse CRISPR...for directed evolution. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas...-directed repair (HDR). ID Plasmid Gene/Insert Promoter Selectable Marker Publication Prime Edit Cas9 ...edits on an RT template. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Interfere Catalytically...Design your gRNA to target your gene of interest’s promoter/enhancer or the beginning of the coding sequence...

  10. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function... on the opposite strand) mutations. ID Plasmid Promoter PI Publication Nick CRISPR/Cas nickase mutants...-directed repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused...edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter PI Publication Interfere Catalytically dead dCas9...Design your gRNA to target your gene of interest’s promoter/enhancer or the beginning of the coding sequence...

  11. Caltech Systemic Capsids

    Type
    Collection
    ... window) . Browse Available PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato... #103006) . Browse Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato...#127847) . Browse Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP...#185136) . Browse Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#185137) . Browse Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175004) . Browse Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175005) . Browse Available CAP-B22 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...

  12. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...interest to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ...plasmid with a promoter that will be functional in your host organism. Host Relevant Promoters Representative...sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated ...proteins, a multiple cloning site (MCS), an inducible promoter, and/or a selectable marker. They are frequently...T-DNA entry plasmid (attR1 & attR2); Zea mays Ubi1 promoter and Hygromiycin resistance marker Also see more... expression under the metallothionein promoter pFastBac LIC and pFastBac Dual LIC - Vectors from...Gileadi lab Worm unc-54, variety of worm gene promoters C. elegans vector kit - Collection...

  13. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable...Gene/Insert Promoter Selectable Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable ...PI Publication Zebrafish ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions...engineered to convert adenosine to inosine, which is treated like guanosine by the cell, creating an A to G ...

  14. mTOR Pathway

    Type
    Collection
    ...signals. mTORC2, which appears to signal upstream of Akt, also promotes cell survival and proliferation. mTOR...anabolic to catabolic processes. Active mTORC1 promotes protein and lipid synthesis, and increases energy... cancer. Loss of the tumor suppressor p53 also promotes aberrant mTORC1 activity, and multiple familial...mTORC1. The hyperactivation of mTORC1 in cancer promotes the conditions needed for uncontrolled cell growth...responds to various signals, including amino acids, stress, oxygen, energy levels, and growth factors. mTORC1...ovarian, and liver cancers. mTORC1 is activated downstream of PI3K/Akt and MAPK/ERK, both of which are commonly...

  15. Validated gRNA Sequences

    Type
    Collection
    ...CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S.... or repression experiments use targets within promoters. When possible, the categories described on Addgene's... 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes...pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949...23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m...GTTGAAAGTATTAGTTAAAG 64388 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate...

  16. Depositor Collections

    Type
    Collection
    ...Community (MCC) Collection Pleiades Promoter Project: mini-promoters to drive selective expression in the...Syndrome Plasmid Collection and Resource Center TREAT-AD Plasmid Collection Visualization Michael Davidson...

  17. Plan Your Experiment

    Type
    Collection
    ...template Cas9 or Cas9 fusions with proteins that promote HDR Requires a repair template Lower editing efficiency...prime editing. CRISPR Intereference : Target the promoter region of the gene of interest, where the Cas9...approaches, the species and expression pattern of the promoter for both your Cas enzyme and gRNA and the presence...the wide range of options for the Cas enzyme, promoters, and selection markers. There are also no packaging...to specific cell types by using cell-specific promoters, which is useful for in vivo studies. While we...transfect, transduce, or may not express common promoters. Browse Cas9 plasmids for RNP delivery . As mentioned...protein product. Be aware that there could be downstream translation start sites that could allow for ...

  18. Worm Expression Resources

    Type
    Collection
    ...recombinase from either a heat-shock promoter or a tissue-specific promoter and expression of the target FLP-out... from either a ubiquitous or a tissue-specific promoter. cGAL and Split cGAL plasmids - Paul Sternberg...Jorgensen Lab. A collection of plasmids that streamlines the production of targeting vectors for tag insertion...

  19. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...sgRNA with U6 promoter 48962 Worm HindIII none S. pyogenes de Bono sgRNA with rpr-1 promoter 48961 Worm ...of two sgRNAs from independent U6 promoters and Cas9 from CBh promoter. Ventura A CRISPR/Cas9 toolkit for...along with 1-4 sgRNAs expressed from independent promoters. sgRNAs are cloned into separate vectors and then... assembly of single gRNA vectors with various promoters, plasmids for assembling multiple gRNAs into one...pGGDestTol2LC vector. Uses five distinct zebrafish U6 promoters for sgRNA expression. Chen pCFD4-U6:1_U6:3tandemgRNAs...expression of two gRNAs from Drosophila U6:1 and U6:3 promoters. Bullock pCFD5 Drosophila Utilizes endogenous ...Zhang Cas9/pTREX-n 68708 Other/Trypanosoma cruzi yes, cut S. pyogenes Neo Docampo tdTomato/pTREX-b 68709 ...

  20. Zhang Lab CRISPR Page

    Type
    Collection
    ...Truncated MeCP2 promoter-driven SpCas9; for neuronal expression 60958 : PX552; U6 promoter-driven; for sgRNA...tyroxine binding globulin (TBG, PX602 [#61593] ) promoter, and a U6-driven single guide RNA. The vector ...codon-optimized SpCas9, driven by the truncated MeCP2 promoter (pAAV-pMecp2-SpCas9-spA) for expressing Cas9 in...FA, Hsu PD, Lin CY, Gootenberg JS, Konermann S, Trevino AE, Scott DA, Inoue A, Matoba S, Zhang Y, Zhang...CRISPR-Cas9 complex. Konermann S*, Brigham MD*, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib...

  21. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...plasmid name for ordering information. ID Name Promoter Description Category PI 157970 pTR-UF11 chimeric...of retinal bipolar cells with improved mGluR6 promoters in rodents and primates. Mol Ther . 2016 Aug;23...by the physiologic body fluids, such as blood, vitreous, CSF, etc. Not suitable as a buffer for vectors...enhanced transduction of the retina following intravitreal injection in mice and marmosets as compared ...enhanced transduction of the retina following intravitreal injection in mice and macaque. This serotype... citations include: Scalabrino, et al. 2015. Intravitreal delivery of a novel AAV vector targets ON bipolar...

  22. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Yannick Doyon 214916 TRE-TDP-43ΔNLS-mClover3 TARDBP mClover3 TRE ALS Ophir Shalem 214917 TRE-mClover3-TDP-43ΔNLS...Yeast Other Promoter CMV T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI ...pEHA1628) SNCA Avi TRE Parkinson's Vikram Khurana 210360 TMEM106B-2Strep TMEM106B Strep CMV, T7 Frontotemporal...Flag CMV ALS Yossi Shiloh 34927 pTRE_tau-LacZ::tTA-H100Y MAPT LacZ TRE Parkinson's, FTD Mark Mayford 35000...telangiectasia Stephen Elledge 43918 tetO-ALN NR4A2 His, V5 TRE Parkinson's John Gearhart 44333 pMX_mTBP TBP LTR ...Douglas Green 50487 pSLIK-NFLAG-hFUS FUS Flag, His TRE ALS Zissimos Mourelatos 51146 DsRed-p150 217-548 ...Dent 188572 Tet-off TauRD (P301L/V337M) MAPT Myc TRE Parkinson's, FTD Franz-Ulrich Hartl 188573 Tet-off...

  23. Zebrafish Plasmid Collection

    Type
    Collection
    ...plasmids with four promoters, six fluorophores, and empty vectors designed to streamline the production of...Zebrafish Society (IZFS) - An organization that promotes and advocates for zebrafish research in the international...

  24. CRISPR Plasmids - RNA Targeting

    Type
    Collection
    ..., and plants. Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacterial ID ...spacer sequence and contain a PAM sequence just downstream of the sequence to be cleaved. This non-specific...

  25. CRISPR Guide

    Type
    Collection
    ...are often used to change an amino acid, turn a promoter on/off, or add small protein tags. Precise Modifications... editors include several fused components that promote the intended repair pathway or inhibit unwanted... converting cytidine to uridine. However, they promote the base excision repair pathway, which fully removes...improved PE2/PE3 to inhibit mismatch repair to promote desired edit epegRNA - addition of a structured...while activation and repression libraries target promoter or enhancer regions. As each library is unique...transcriptional repressors or activators and targeting promoter regions. You might sometimes see these referred...the methylation state of cytosines in a gene’s promoter or by inducing histone acetylation or demethylation...

  26. CRISPR Plasmids - gRNAs

    Type
    Collection
    ... or repression experiments use targets within promoters. Do you have gRNAs you'd like to add to the Addgene...wild-type SpCas9 must be used with targets that are upstream of a 5' NGG 3' PAM sequence. Which CRISPR application...

  27. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ... 20-mer is not G. sgRNA expression from the U6 promoter of the pX330 vector is enhanced by the inclusion...each sample and sequence each colony using a U6 promoter forward primer: CGTAACTTGAAAGTATTTCGATTTCTTGGC...non-deletion band”) and another set of primers upstream and downstream of the sgRNA cleavage sites (“deletion ...sequences consist of a 20-mer (“protospacer sequence”) upstream of an “NGG” sequence (“protospacer adjacent motif...consists of DMEM supplemented with 2% penicillin/ streptomycin and 1% L-glutamine, which is used for MEL cells...

  28. p53 Pathway

    Type
    Collection
    ... the best-characterized effects of p53 are in promoting cell cycle arrest, apoptosis, or senescence in...suppressor activated by cellular stresses like DNA damage, oxidative stress, and nutrient deprivation. p53...factor and tumor suppressor activated by cellular stress. Cancer...

  29. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...sequence (PFS). In bacteria, Cas13 targeting also promotes non-specific RNA cleavage, but this non-specific...mouse, and rat) Bacteria ( E. coli , Streptococcus , Streptomyces , and others) Drosophila Plants (monocots...20 bp in length and paste them into contiguous stretches of DNA known as CRISPR arrays. Separate Cas proteins...proteins or RNAs through ChIP (enChIP) or biotin-streptavidin pulldown (CAPTURE.) Tag : Multiple methods make...exploring therapeutic applications of CRISPR to treat genetic disease, with the caveat that off-target...

  30. Plasmids for Stem Cell Research

    Type
    Collection
    ...lentiviral plasmids The acetyllysine reader BRD3R promotes human nuclear reprogramming and regulates mitosis...Nature. 2011 Jul 13. doi: 10.1038/nature10323. Crabtree Fibroblasts Motor Neurons Retroviral Mouse/Human...

  31. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...into the p1316 plasmid that contains an upstream CMV promoter for light chain expression, and an ER signal... and heavy (blue) chains as driven by two CMV promoters (orange). Hybridoma-derived V L and V H domain...light chain polyA tail sequences (κ pA), a CMV promoter for heavy chain expression, and an ER signal/leader...DEPDC5 Human Mouse IgG2a 206594 Anti-TRESK K+ channel [N467/1R] TRESK K+ channel Mouse Mouse IgG2a 206595...Mouse IgG2a 225384 TREK-1 K+ channel (Mus musculus) recombinant monoclonal antibody. TREK-1 K+ channel Mouse...translocation of the light chain across the ER membrane. Downstream of the insert is a heavy chain constant domain...

  32. Immunology Research Plasmids and Resources

    Type
    Collection
    ... MCH2, MCH2R, SLT MDK midkine (neurite growth-promoting factor 2) FLJ27379, MK, NEGF2 MET met proto-oncogene... different fluorescent proteins, 10 mammalian promoters and enhancers, 3 polyA signals as well as selection...antigens through the B cell receptor (BCR). The strength and duration of signaling controls the fate of...Growth Factor beta (TGFbeta) signaling and its downstream effector molecules, the Smad proteins, regulate...KIAA0403, LMOR, MOR, MOR1, OPRM OSGIN1 oxidative stress induced growth inhibitor 1 BDGI, OKL38 OSM oncostatin...SRP, UCN-II, UCNI, UR, URP UCN3 urocortin 3 (stresscopin) MGC119002, SCP, SPC, UCNIII UTS2 urotensin 2...
Showing: 1 - 32 of 32 results