We narrowed to 131 results for: cat
- 
  TypeCollection...pAAV-DIO-EF1α-mKate2-PDE4D3-Cat EF1a-driven, Cre-dependent Cre-dependent expression of mKate2 and a truncated human PDE4D3... Tools for Affinity Purification These AAV encode tools for affinity purification (which can be used for...tet-off transactivators and tools for affinity purification (TRAP). Viral... Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell Ablation Genome Engineering...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...
- 
  Validated gRNA SequencesTypeCollection...Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish. Validated...Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut ...Wolfe LYP1 S. cerevisiae CATAATAACGTCCAATAAAT 60847 cut S. pyogenes 25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC... sapiens GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut...sapiens TGACATCAATTATTATACAT cut S. pyogenes 26789497 Corn CXCR4 H. sapiens CCTCTTTGTCATCACGCTTC cut S.... sativa CATATAGTTGGGTCATGGCA cut S. pyogenes 26479191 Kim DWD1 O. sativa TGCATCGTCCAAGCGCACAG cut S. pyogenes...upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR...
- 
  Fluorescent Protein Guide: BiosensorsTypeCollection...encoded sensor and small molecule indicator: implications for quantification of cytosolic Zn(2+). ACS Chem... few popular categories of biosensors or browse all the biosensors tagged in our catalog . Use the article...Calcium Indicators (Constitutive or Cre-dependent) jGCaMP8 Fast Genetically Encoded Calcium Indicators. Janelia...calcium indicators for optical imaging (GECOs), including blue, green, red, and ratiometric indicators An ...fluorescent calcium ion indicator OCaMP A sensitive orange fluorescent calcium ion indicator for imaging neural...calcium indicator for fluorescence using HaloTag ligands A modular chemigenetic calcium indicator enables...fluorescence indicator of K+ for optical imaging (GINKO) Genetically encoded fluorescent indicators for imaging...
- 
  CRISPR GuideTypeCollection... organisms, but modifications to various Cas enzymes have extended CRISPR applications to increasingly...following the amplification protocol specified by the depositing lab. After amplification, you’ll need ...heritability. Not all modifications are stable across cell divisions, and some types of modifications are more frequently... subsequently isolated by affinity purification. After purification, molecules associated with the locus...conventional methods for genomic purification, CRISPR-based purification methods are more straightforward...and SHERLOCKv2) allows for greater amplification and quantification and can be used on lateral flow strips...table above, 3' and 5' indicate on which end of targeted sequence the PAM is located. The majority of the...
- 
  Antibody GuideTypeCollection...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification... Read on to learn more about the applications common to each category, including an outline of the basic...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...concentrates in the sample. Controls for quantification methods Quantification methods should be run with: a positive...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...production and storage techniques, and explain common applications. Science...
- 
  CRISPR Plasmids - Mammalian ExpressionTypeCollection...Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...Selectable Marker PI Publication Epigenetics To make targeted epigenetic modifications, researchers have ...DNA. Fusing the catalytic domain of ADAR2(E488Q) adenosine deaminase to catalytically dead Cas13b creates... Gene/Insert Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used...Insert Promoter Selectable Marker PI Publication Visualize A catalytically inactive Cas9 (dCas9) fused to a...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...
- 
  Zinc Finger Consortium: Zinc Finger ArraysTypeCollection...OPEN gAGCATCACCtcgctGGAGGTGAGc PTRF/Cavin1 OZ513 and OZ514 OPEN OPEN gACAGCCGTCtgcatctGGAGGTGCCc pitrm1...OPEN OPEN aGCCATCATCaggttcaGGATGAGCCc Kif6 OZ537 and OZ538 OPEN OPEN aAGCTTCCTCttcattgGCTGACTGCa ldr (low...CODA OPEN cAACCTCAGCATAAAGCTGGAGGAg psen2 OZ577 and OZ578 CODA OPEN cGGCATCTCCAGAGCCCGAGGCGGACc zgc:162148...hydroxylase (dbh) OZ525 and OZ526 OPEN OPEN tCCCATCCTAtcgttGCATGAGCTc mdka (midkine-related growth factor) OZ527...lipoprotein receptor) OZ539 and OZ540 OPEN OPEN tTGCATCCACggcagTCGGCAGTGc Encephalopsin (Opn3) OZ541 and OZ542 OPEN... OPEN OPEN aTCCATCCCAaacacatGTGGCAGAAt NFATc1 OZ543 and OZ544 OPEN OPEN aCCTCGCCTCagtgtGACGGAGGAc Swachmann-Bodian-Diamond...gCGCCACGGAcaataaaGAGGACTGCa GUSB OZ551 and OZ552 OPEN OPEN gGTCATCTGCcattcGAGGCGGACa REST corepressor 2 OZ553 and OZ554 OPEN...
- 
  CRISPR Plasmids - Purify Genomic LociTypeCollection...Catalytically inactive CRISPR plasmids for purification of target loci....conventional methods for genomic purification, CRISPR-based purification methods are more straightforward and...plasmids designed for the purification of genomic loci. To learn more about purification using CRISPR and other...chromatin immunoprecipitation (ChIP) to allow purification of any genomic sequence specified by a particular...DNA-binding molecule-mediated ChIP) system, catalytically inactive dCas9 is used to purify genomic DNA... can be fused to dCas9 or gRNA for efficient purification. Various epitope tags including 3xFLAG-tag, ...The locus is subsequently isolated by affinity purification against the epitope tag. Compared to conventional...
- 
  CRISPR History and Development for Genome EngineeringTypeCollection...development of new applications. The first CRISPR papers described two main categories of genome edits. ... lower off-target cleavage frequency. Truncated gRNAs: Truncated gRNAs display less off-target activity...therapeutic applications. Despite the ethical controversies surrounding non-research applications, it’s clear...just as useful (if not more so) for research applications, eclipsing past genome engineering technologies...number/types of Cas proteins. Makarova et al. ’s classification defines 5 types and 16 subtypes based on shared...for CRISPR genomic editing. Genome Engineering Applications In 2012, Jinek et al. first demonstrated that... PubMed lists more than 6,300 CRISPR-related publications, many of which detail work to improve the tool...
- 
  CRISPR Plasmids - BacteriaTypeCollection...ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a transcriptional... Plasmid Gene/Insert Promoter PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...population. ID Plasmid Promoter PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function Genome Editing...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...gRNA Design Tools CRISPR Blog Posts Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein...
- 
  Empty Backbones - Choosing Your Perfect Plasmid BackboneTypeCollection...plasmids containing only the elements needed for replication in the host cell and are designed for a user ...Protein Function: Viral Vector Delivery, Genome Modification, mRNA Regulation, and More Selectable Markers...collection page Zebrafish CMV, h2afv, XlEef1a1 See our dedicated Zebrafish Plasmids and Resources collection page...Additionally, tags are commonly added to aid in protein purification. Just remember to remove the stop codon for ...myristoylation signal GST Protein purification pEBG - N-terminal GST for mammalian...expression GST plasmids made by Addgene MBP Protein purification pET28-MBP-TEV - Bacterial expression with MBP-TEV...MBP-tagged fusion proteins in E. coli SUMO Protein purification pCIOX - Bacterial expression vector for His8...
- 
  Immunology Research Plasmids and ResourcesTypeCollection... CAMP cathelicidin antimicrobial peptide CAP18, CRAMP, FALL-39, FALL39, HSD26, LL37 CAT catalase MGC138422...hCD40L CD70 CD70 molecule CD27L, CD27LG, TNFSF7 CECR1 cat eye syndrome chromosome region, candidate 1 ADGF,...CREB, MGC9284 CTSB cathepsin B APPS, CPSB CTSE cathepsin E CATE CTSL1 cathepsin L1 CATL, CTSL, FLJ31037,...phosphoinositide-3-kinase, catalytic, delta polypeptide p110D PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide...and adaptive immune signaling and cell-cell communication. Plasmid...
- 
  CRISPR Plasmids - YeastTypeCollection...Insert Promoter Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase...Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...
- 
  CRISPR Plasmids - EpigeneticsTypeCollection...make targeted epigenetic modifications, researchers have fused catalytically dead Cas9 (dCas9) to epigenetic...designed for epigenetic modification. To learn more about epigenetic modification with CRISPR and other ...CRISPR plasmids for targeted epigenetic modification, including histone acetylation/demethylation, and...removal of H3K4 and H3K9 methylation Epigenetic modification is typically targeted to a specific promoter...or enhancer for your gene of interest. These modifications persist over time and are potentially heritable...chromatin state. Figure 1: Overview of epigenetic modification using CRISPR. Created with BioRender.com. Browse...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter...
- 
  Plan Your ExperimentTypeCollection...Achieving your desired edit comes down to location, location, location. Positioning your chosen Cas enzyme ...designing the gRNA component for each category. Genetic Manipulation Application Cas Enzyme Additional Considerations...the table below, we highlight the most common categories of genetic manipulations used in mammalian cells...gene you target will depend on your specific application. Knockout : Target constitutively expressed regions...start sites that could allow for expression of a truncated protein. Targeting an exon coding for an essential... Select a cut site as close as possible to the location of the desired edit, ideally less than 10 bp away...complex. You then delivery the RNP to cells using cationic lipids, electroporation, or an endosomal approach...
- 
  Cre-Lox and Other Site-Specific RecombinasesTypeCollection...target sites, and catalyzes recombination between them. Most SSR enzymes are categorized into two distinct...a genomic attP site. So far, their practical application has been limited by low integration efficiency...after recombination (inversion, deletion, or translocation) depends on the orientation of each target site...are on separate DNA molecules (in trans), a translocation event is generated between the target sites....(Length) Common Variants Cre loxP ATAACTTCGTATAgcatacatTATACGAAGTTAT 13 bp inverted repeats + 8 bp spacer...By expressing the enzyme at specific times or locations using cell-specific promoters or inducible systems... used for more than inversion, deletion, or translocation of a gene of interest. Using Cre or Flp as examples...
- 
  CRISPR Plasmids - Double-Strand Break (Cut)TypeCollection...Marker PI Publication Return to top Bacteria ID Plasmid Gene/Insert Promoter PI Publication Return to ...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter...Promoter Selectable Marker PI Publication Return to top C. elegans ID Plasmid Gene/Insert Promoter Selectable...Selectable Marker PI Publication Return to top Yeast ID Plasmid Gene/Insert Promoter Selectable Marker ...Marker PI Publication Return to top Zebrafish ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top Parasite ID Plasmid Gene/Insert...
- 
  CRISPR Plasmids - PlantsTypeCollection...Gene/Insert Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase...Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...
- 
  University of Florida Serotype Testing Panel for the Eye and BrainTypeCollection... any application Balanced Salt Solution (BSS) An ophthalmic solution suitable for any application TMN200...ordering information. ID Name Promoter Description Category PI 157970 pTR-UF11 chimeric CMV/Chicken Beta actin...When using the AAV2(Y444F) serotype in future publications, please acknowledge Arun Srivastava and cite...When using the AAV2(trpYF) serotype in future publications, please acknowledge Arun Srivastava and cite... using the AAV2(4pMut)dHS serotype in future publications, please acknowledge Shannon Boye and cite Boye...using the AAV6(dbY-F+T-V) serotype in future publications, please acknowledge Arun Srivastava and cite...Strategies for Overcoming Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495....
- 
  Bacterial Expression SystemsTypeCollection...for protein purification. The pTD Plasmid Series contains plasmids suitable for replication in many gram-negative...expression plasmids that can be used for protein purification, protein visualization, study of protein interactions...Systems Bacterial Expression Systems Protein Purification Protein Visualization Protein Interactions Controlled...Bacteria are commonly used to create, store, and replicate plasmids of all types, but beyond that, researchers...expression plasmids to find out more! Protein Purification To study the function, structure, and activity...through affinity chromatography. To facilitate the purification process, proteins are often expressed alongside...Browse our most popular plasmids for protein purification. Commonly used tags, cleavage sites, and signal...