Skip to main content
Addgene
Showing: 1 - 20 of 28 results

  1. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... 12165 pSico Dnmt1 DNMT1 GFP CMV Hereditary sensory neuropathy type IE Tyler Jacks 12166 pSicoR Dnmt1 ...TREtight Huntington's Nico Dantuma 23971 VCP(wt)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma 23972 VCP(R155H...His, GFP, HA CMV ALS Nico Dantuma 23973 VCP(A232E)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma 23974 VCP(...Spinocerebellar ataxia 18 Nicola Burgess-Brown 39042 GAK GAK TEV, His T7 Parkinson's Nicola Burgess-Brown 39529...FUS His, MBP T7 ALS Nicolas Fawzi 98652 MBP-FUS_FL_12E FUS His, MBP T7 ALS Nicolas Fawzi 98653 MBP-FUS_LC_WT...FUS His, MBP T7 ALS Nicolas Fawzi 98654 MBP-FUS_LC_12E FUS His, MBP T7 ALS Nicolas Fawzi 98655 MBP-FUS_FL..._FL_6E FUS His, MBP T7 ALS Nicolas Fawzi 98656 FUS_anion FUS T7 ALS Nicolas Fawzi 98657 hnRNPA2_LC_WT ...

  2. Cre-lox system

    Type
    Collection
    ...similar plasmids pSicoR PGK puro , pSicoR-Ef1a-mCh-Puro , pSicoR-Ef1a-mCh and pSicoR-mCh-empty Lentiviral...PI 11578 pSico Cre activates shRNA expression, removal of EGFP; See also similar plasmids pSico PGK GFP...GFP and pSico PGK puro Lentiviral Jacks 11579 pSicoR Cre turns off shRNA expression, removal of EGFP; See...

  3. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Campbell Voltage Multicoloured voltage reporters (QuasAr2) Bright and fast multicoloured voltage reporters...plasmids; these are noted with the viral service icon . Metal Ions Target Description Article PI Calcium...Biol. 2010 Apr 16;5(4):415-25. Martin Webb ATP Multicolor palette of ATP indicators (MaLion) RGB-color ...Cell Rep. 2019 Jun 25;27(13):4003-4012.e6. Xavier Nicol cyclic di-GMP FRET-based biosensor for cyclic-di-GMP...biosensors for mapping cellular concentrations of nicotinamide adenine dinucleotides. eLife. 2018 May 29;7.... and green GPCR-based NE indicators Sensitive multicolor indicators for monitoring norepinephrine in vivo...elevations. J Biol Chem. 2011 Apr 1;286(13):11672-84. Nicolas Demaurex pH Rosella Fluorescent pH-biosensor for...

  4. Validated gRNA Sequences

    Type
    Collection
    ... T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola 24076762...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...musculus 64071 cut S. pyogenes 25337876 Ventura Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG 70660 cut...GCGCTTACACTTTAGGAGACACTC 61080 purify S. pyogenes 25051498 Fujii JAK2 amplicon H. sapiens GGTTTAATGGAAGAGAAGGG 70679 cut S. pyogenes... 70018 cut S. pyogenes 26541286 Voytas BCR/ABL amplicon H. sapiens GGCTCCCTTCAAGTGGGATG 70658 cut S. pyogenes...

  5. CRISPR References and Information

    Type
    Collection
    ... you'll need Sanger sequencing reads from PCR amplicons that cover your locus of interest and correspond... from a deep sequencing experiment a reference amplicon sequence to assess and quantify the efficiency...efficiency of the targeted mutagenesis The amplicon sequence expected after HDR can be provided as an optional...CRISPResso suite accommodates single or pooled amplicon deep sequencing, WGS datasets and allows the direct...

  6. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol Marraffini... pKS diaCas9_sgRNA 74923 Other/Phaeodactylum tricornutum U6 yes, cut S. pyogenes Winge pJJR50 75026 Worm...gRNA module vectors, including three designed for dicots and three designed for monocots. Using these gRNA...High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants Plant PCR-based procedure to rapidly generate...

  7. Plant Plasmids and Resources

    Type
    Collection
    ... targeted, specific modification of monocot and dicot genomes using genome engineering; validated in tomato...backbones, and promoters for expression in monocots and dicots - Vladimir Nekrasov. The MoClo-compatible zCas9i...high-efficiency multiplex genome editing in monocot and dicot plants - Yao-Guang Liu. Plasmids for prime editing...

  8. Genetic Code Expansion

    Type
    Collection
    ...ribosome and if the anticodon on the tRNA can bind to the mRNA (hence, the anticodon is complementary to... variant inactivated by the truncation of the anticodon loop). Expresses archaeal MjTyrRS/tRNA pair instead...

  9. CRISPR Guide

    Type
    Collection
    ...natural Cas orthologs include Hsp1Cas9 (from Helicobacter sp. MIT 11-5569 ) and Nme2Cas9 (from Neisseria...paralogs or lncRNAs . Guide RNAs are designed in silico and synthesized (Figure 8A), then cloned in a pooled...fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR imaging can be achieved by using orthogonal...Streptococcus thermophilus (ST) 3' NNAGAAW Treponema denticola (TD) 3' NAAAAC Additional Cas9s from various species...Wolfe, S. A., Zhang, S., & Pederson, T. (2015). Multicolor CRISPR labeling of chromosomal loci in human ...

  10. Immunology Research Plasmids and Resources

    Type
    Collection
    ...T-lymphocyte-associated protein 4 CD, CD152, CELIAC3, CTLA-4, GSE, ICOS, IDDM12 FOS v-fos FBJ murine osteosarcoma viral ...CTLO, H-RASIDX, HAMSV, HRAS1, K-RAS, N-RAS, RASH1 ICOS inducible T-cell co-stimulator AILIM, CD278, MGC39850...14, CST-17, CST-29 CRH corticotropin releasing hormone CRF CRHR1 corticotropin releasing hormone receptor...CRF-R, CRF1, CRFR1, CRH-R1h, CRHR, CRHR1f CRHR2 corticotropin releasing hormone receptor 2 CRFR2 CRIM1 cysteine...MSH-R, SHEP2 MC2R melanocortin 2 receptor (adrenocorticotropic hormone) ACTHR, MGC125798 MC3R melanocortin...MTNR1B melatonin receptor 1B MEL-1B-R, MT2 NAMPT nicotinamide phosphoribosyltransferase 1110035O14Rik, DKFZp666B131...nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) GCCR, GCR, GR, GRL NR3C2 nuclear ...

  11. Fluorescent Protein Guide: In Vivo Imaging

    Type
    Collection
    ... effective brightness and allow for single or multicolor imaging. Photo-activatable iRFPs can be ‘turned...empty backbone plasmids are ideal for single or multicolor in vivo imaging. Plasmids for In Vivo Imaging...

  12. Mammalian RNAi Tools

    Type
    Collection
    ...Lentivectors Toolbox Optimized shRNA design in pSico with pSicoligomaker (Andrea Ventura lab) References Carthew...

  13. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...Streptomyces , and others) Drosophila Plants (monocots and dicots) C. elegans Yeast ( S. cerevisiae and S. pombe ...Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. 2015. Multicolor CRISPR labeling of chromosomal loci in human ...

  14. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...is critical that the deletion and non-deletion amplicons be easily resolved on an agarose gel for multiplexing... with a proofreading polymerase and clone the amplicons ( e.g., with a PCR cloning kit) into a plasmid...

  15. Zhang Lab CRISPR Page

    Type
    Collection
    ...codon-optimized SpCas9; sgRNA can be co-transfected as PCR amplicons (Ran et al., Nature Protocols 2013). Individual...SaCas9; SaCas9 sgRNA can be co-transfected as PCR amplicons using a protocol similar to SpCas9 sgRNA PCR (...

  16. Bacterial Expression Systems

    Type
    Collection
    ...terminal GST tag with TEV cleavage site to remove tag Nicola Burgess Brown pGEX expression vector with N-terminal...purification from the Structural Genomics Consortium and Nicola Burgess Brown containing a variety of tags can ...

  17. Luciferase Plasmid Collection

    Type
    Collection
    ...plasmids; these are noted with the viral service icon . ID Plasmid Luciferase Type Promoter Description...Firefly EF1α AAV expression of firefly luciferase Nicole Paulk 98294 pF CAG luc IRES neo Firefly CAG Lentiviral...

  18. Chemogenetics Plasmids

    Type
    Collection
    ... KORD are inhibitory. PSAMs are engineered α7 nicotinic acetylcholine receptor (nAChR) domains that respond...

  19. Synthetic Biology - Overview

    Type
    Collection
    ...Gabor Balazsi Matthew Bennett Carolyn Bertozzi Nicolas Buchler George Church Cynthia Collins James Collins...
Showing: 1 - 20 of 28 results