We narrowed to 71 results for: MUT
-
TypeCollection... create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker...Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in ...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce...
-
CRISPR Plasmids - Bacteria
TypeCollection...opposite strand) mutations. ID Plasmid Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce... -
CRISPR Plasmids - Plants
TypeCollection... create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker...Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in ...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce... -
Neurodegeneration Research Collection
TypeCollection...dominant manner, are associated with known genetic mutations in one of the following genes: SOD1, C9ORF72, ... huntingtin (HTT) gene. An individual with the mutated HTT gene will have huntingtin proteins with abnormally...-onset forms, a fraction of these are due to a mutation in one of three different inherited genes: Presenilin... collection of plasmids expressing wild type or mutant ORFs, gene fragments, and gRNAs for genes linked... -
CRISPR History and Development for Genome Engineering
TypeCollection...precise gene editing. These edits can include mutations seen in human patients, protein tags, or loxP/...editing rates. Advances in this area include: Nickase mutant: cuts only one strand of DNA and can be used with...off-target activity due to rationally designed mutations. Researchers have expanded the CRISPR field beyond...to be used together. Researchers have engineered mutant Cas enzymes with alternative PAM sites . Cpf1 ,... -
Tetracycline Inducible Expression
TypeCollection...tetracycline-controlled transactivator (fusion of mutated TetR with VP16 transcriptional activation domain... (Tet-On) In 1995, Gossen et al. used random mutagenesis to identify the amino acid residues of TetR that...important for tetracycline-dependent repression. Mutating these residues led to a reverse Tet repressor,...tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity . Proc Natl... -
CRISPR Plasmids - Single-Strand Break (Nick)
TypeCollection...Bacteria Drosophila Plant Yeast Resources Cas nickase mutants introduce gRNA-targeted single-strand breaks in...created by wild-type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce... -
CRISPR Plasmids - Drosophila
TypeCollection...Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...different types of target sites available, both mutant and wild type. The ability to manipulate the number...Recombinase-mediated cassette exchange (RMCE): When matching but mutually incompatible recognition sites flank both a DNA...experimental results. Attenuated iCre(R297T), a point mutant iCre variant, reduces the number of recombination... -
Luciferase Plasmid Collection
TypeCollection...Firefly Insertion of 5' promoter/enhancer regions. Mutations within the luciferase gene allow for increased...Renilla CMV Mammalian expression Renilla luciferase mutant Rluc8, which has increased stability and light ...luciferases : A set of three increasingly destabilized mutants which serve as sensors of proteome stress. pHLuc... -
Zhang Lab CRISPR Page
TypeCollection...loss-of-function mutations in p53 and Lkb1 , as well as homology directed repair-mediated Kras G12D mutations, leading...KRAS , p53 and LKB1 , the top three significantly mutated genes in lung adenocarcinoma. Delivery of a single... -
Fluorescent Protein Guide: Biosensors
TypeCollection...construct leads to a change in signal of a circularly permuted fluorescent protein (cpFP) or fluorescence resonance...Yasushi Okada ATP (extracellular) GRAB_ATP1.0/ATP1.0mut biosensor for extracellular ATP (Constitutive ...1147-1155. Lin Tian Endocannabinoid GRAB_eCB2.0/eCBmut biosensor for endocannabinoids in vivo (Constitutive...pHluorin2 for pH sensing The zebrafish merovingian mutant reveals a role for pH regulation in hair cell toxicity... -
Validated gRNA Sequences
TypeCollection...elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG...CGGAGCTGATCACTGACA 72890 cut S. pyogenes 26429889 Katsanis GFPmut3b A. victoria ACCATCTAATTCAACAAGAATT 73221 interfere... 72628 cut S. pyogenes 26493208 Guigo, Johnson GFPmut3b synthetic ACCATCTAATTCAACAAGAATT 73224 interfere... -
Ginkgo Bioworks COVID-19 Collection
TypeCollection...SUMO, GST, MBP, CBP, S-tag, TAP tag, TRX, or V5) Mutations Wild type (wt) Codon-optimized expression (recode...making pseudovirus (Ctrunc) ID Plasmid Description Mutations Tags Industry Additional Addgene Resources Blog... -
CRISPR Plasmids - Base Edit
TypeCollection...spectrum of single-nucleotide variants (somatic hypermutation) in a wider editing window, and are thus well...editing systems include targeted AID-mediated mutagenesis (TAM) from the Xing Chang lab and CRISPR-X from... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection...ZFNs) are effective tools for making targeted mutations in zebrafish. With support from the NIH and guidance...):1471-1501. PubMed PMID 19798082 . Targeted mutagenesis in zebrafish using customized zinc-finger nucleases... -
AAV Molecular Tools
TypeCollection...-mPCSK9 hAAT-driven, constitutive Expression of mutant (D377Y) murine PCSK9 for studying hypercholesterolemia... microtubule-associated protein tau with P301L mutation 1 Tsuneya Ikezu 203840 pAAV-hSyn-Kir2.1WT-2A-mScarlet-KASH... -
Adeno-associated virus (AAV) Plasmids
TypeCollection...name, capsid, and more. ID Plasmid Gene/Insert Mutations PI AAV Plasmids This table contains a general .... ID Plasmid Gene/Insert Vector Type Backbone Mutations Tags PI Do you have suggestions for other plasmids... -
Plant Plasmids and Resources
TypeCollection...(Link opens in a new window) for Targeted Gene Mutation in Rice - Yinong Yang. The MoClo CRISPR/Cas Toolkit...assembly for fast generation of multiple Arabidopsis mutants - Niko Geldner. CRISPR-Cas9 vector with GRF4-GIF1... -
Zebrafish Plasmid Collection
TypeCollection...Keith Joung Lab CRISPR/Cas9-based conditional mutagenesis in zebrafish - Wenbiao Chen Lab A CRISPR/Cas9... typically relies on genetic markers, somatic mutations, or labeling with fluorescent proteins to visualize...