Skip to main content
Addgene
Showing: 21 - 40 of 77 results
  1. AAV Packaged on Request

    Type
    Collection
    ...yields are generally lower, with a minimum titer of 2 × 10 12 GC/mL and a typical titer of 7 × 10 12 GC/... 10 weeks. This breaks down as follows: Request 1–2 days Look for the banner on an eligible plasmid page... your request. We will send you an email within 1-2 days with a response. Most requests will be approved...make sure it is ready for your experiments. Shipping 2–7 days We will email you with tracking information...implementation letter DNA amplification Viral vector production Density centrifugation purification Addgene’s comprehensive...preps, which includes MTA facilitation, DNA amplification, and high-quality quality control measures such...order ships. Shipping time will depend on your location. Share Your Results Once you start getting results...
  2. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...James M. Wilson AV-2-27056 27056-AAV2 pAAV-Ef1a-DIO EYFP Control Karl Deisseroth AV-2-ALL854 51502-AAV2...Hongkui Zeng AV-2-PV0101 105530-AAV2 pAAV.CMV.PI.EGFP.WPRE.bGH Control James M. Wilson AV-2-PV0101 105530...Wilson AV-2-PV1090 105537-AAV2 pENN.AAV.CMVs.Pl.Cre.rBG Cre Recombinase James M. Wilson AV-2-PV2004 105545...Wilson AV-2-26967M 100049-AAV2 pAAV.hSynap.ChETA(E123T/H134R)-eYFP.WPRE.hGH Karl Deisseroth AV-2-35505 35505...EYFP Karl Deisseroth AV-2-PV0102 105531-AAV2 pAAV.CMV.LacZ.bGH James M. Wilson AV-2-PV1917 105541-AAV2 pENN.AAV.CamKII0.4...pAAV.CMV.PI.EGFP.WPRE.bGH Control James M. Wilson AV-2-PV1963 105542-AAV2 pENN.AAV.CB7.CI.eGFP.WPRE.rBG Control... pAAV-Syn-ChrimsonR-tdT Optogenetics Ed Boyden AV-2-26969P 26969-AAV2 pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics...
  3. Qi Lab CRISPR Page

    Type
    Collection
    ...could cause up to 300-fold repress on targeted genes. 2. Two-plasmid CRISPRi system for mammalian gene knockdown...of both plasmids in HEK293 cells could cause up to 2~3-fold repress on targeted fluorescent genes. These...promoter and sgRNA targeting GFP (NT1) 46917 pU6-sgCXCR4-2 Human pSico-based U6 vector containing murine U6 promoter... UAS promoter (negative control) 46918 pU6-sgCD71-2 Human pSico-based U6 vector containing murine U6 promoter...Plasmid Description 44246 pdCas9-humanized A catalytically inactive, human codon-optimized Cas9 expression...expression plasmid 44247 pdCas9::BFP-humanized A catalytically inactive, human codon-optimized Cas9-BFP fusion...codon-optimized Cas9 constructs 44249 pdCas9-bacteria A catalytically inactive bacterial Cas9 expression plasmid 44250...
  4. Plasmids for Stem Cell Research

    Type
    Collection
    ...mouse somatic cells. Cell Stem Cell. 2008 Feb 7. 2(2):151-9. Jaenisch Lentivirus Mouse Polycistronic, ... iPSCs by a synthetic self-replicative RNA. Cell Stem Cell. 2013 Aug 1;13(2):246-54. Dowdy Adenovirus ...Nature of Induced Pluripotency. Cell. 2015 Jul 16;162(2):412-24. Mikkelsen Lentivirus Human Expression of ...reprogramming in mouse. Cell Stem Cell. 2008 Mar 6. 2(3):230-40. Hochedlinger MMLV-derived Retrovirus Mouse...Lentiviral Human Small molecules enable neurogenin 2 to efficiently convert human fibroblasts into cholinergic...Conversion of Fibroblasts. Neuron. 2014 Oct 22;84(2):311-23. Yoo Fibroblasts Neurons Lentiviral Human ...
  5. Zhang Lab CRISPR Page

    Type
    Collection
    ...SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A nickase) + CRISPR RNA array... system - lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9-Blast and lentiGuide-Puro...two MS2 RNA aptamers at the tetraloop and stemloop 2 The MS2-P65-HSF1 activation helper protein Full references...backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites...inverted terminal repeats (ITR) from AAV serotype 2. SaCas9 only: This plasmid ( PX600, #61592 ) contains...Epub 2013 Aug 29. Erratum in: Cell. 2013 Oct 10;155(2):479-80. PubMed . Genome engineering using the CRISPR-Cas9... Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016/j.cell.2014.09.014. Epub 2014...
  6. mTOR Pathway

    Type
    Collection
    ...known as RPS6KB1; Ribosomal protein S6 kinase B1 TSC1/2 TSC1 TSC2 Tuberous sclerosis VHL Von Hippel-Lindau...Rictor RPTOR independent companion of MTOR, complex 2 SGK Serum/glucocorticoid regulated kinase 1 Return...disease. Laplante M, Sabatini DM. Cell. 2012 Apr 13;149(2):274-93. doi: 10.1016/j.cell.2012.03.017. PubMed PMID...cell and regulates the switch from anabolic to catabolic processes. Active mTORC1 promotes protein and ...energy-intensive processes. mTORC1 also blocks catabolic processes including autophagy and lysosome biogenesis... below. Color is used for clarity and does not indicate a specific relationship. The content for this ...Pathway Color is used for clarity and does not indicate a specific relationship. The content for this ...
  7. CRISPR Plasmids - Double-Strand Break (Cut)

    Type
    Collection
    ... with 1. homology to the DNA flanking the DSB and 2. a specific edit close to the gRNA PAM site. When ...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid...Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication C. elegans...Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Zebrafish...Marker PI Publication Xenopus ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Parasites...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...
  8. Rett Syndrome

    Type
    Collection
    ... mutations in the gene methyl-CpG binding protein 2 ( MECP2 ). MECP2 Rett syndrome is an X-linked disorder...X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet . 23, 185–188. (Link opens in a new window... Cuddapah et al. 2014. Methyl-CpG-binding protein 2 (MECP2) mutation type is associated with disease severity... Specific mutations in methyl-CpG-binding protein 2 confer different severity in Rett syndrome. Neurology...males with mutations in Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet . 180, 55–67... disruptions, missense mutations located in the MBD, and truncations prior to the NID are more severe ...even within patients with the same mutation, the location and type of MECP2 mutation can be a strong predictor...
  9. Validated gRNA Sequences

    Type
    Collection
    ...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT...S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus GTCAAGATGTCATCTTACGG 60971 cut S. pyogenes 24967838 Mashimo...alpha 1 H. sapiens GAAGATCGGCCACTACATTC 74375 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens GAAGATCGGACACTACGTGC 74377 nick S. pyogenes...
  10. Neurodegeneration Research Collection

    Type
    Collection
    ...different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of individuals develop...study aggregation. Saha et al. Nat Commun. 2023 Feb 2. Study the C terminal domain of TDP-43 to better understand... rodent species. Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 ...with the iPSC toolbox . Lam et al. bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression...loci seem to be associated with the disease and implicate a wide range of cellular processes. The vast majority... consists mainly of managing symptoms through medication and surgery. PD primarily involves the malfunction...available from Addgene, sortable by type of genetic modification and target species. You can also find our guide...
  11. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...Layer 2-3_IT Isocortex 230803 pAAV-AiE2638m-minBG-iCre(R297T)-BGHpA AiP20142 AiE2638m Cre Layer 2-3_IT ...Layer 2-3_IT Isocortex 220727 pAAV-AiE2543m-minBG-iCre(R297T)-BGHpA AiP2048 AiE2543m Cre Layer 2-3_IT ...Layer 2-3_IT Isocortex 230402 pAAV-AiE0680m-minBG-iCre(R297T)-BGHpA AiP15072 AiE0680m Cre Layer 2-3_IT ...Capsids AAV Packaged on Request AAV Guide Plasmids Publications Enhancer AAV plasmids are plasmids which use...= Substantial non-specific labeling observed Publications Ben-Simon Y, Hooper M, Narayan S, Daigle T, ...
  12. Lentiviral Prep Service

    Type
    Collection
    ...Barcode Library Version 2 Ready-to-use lentiviral particles carrying version 2 of the CellTag barcoding...barcoding library. Version 2 of the Celltag library contains 4934 barcodes to combinatorially index cells for... Accessories for Activating Gene Expression Catalytically-dead Cas9 (dCas9) can be fused to a transactivator...
  13. AAV Molecular Tools

    Type
    Collection
    ...constitutive Expression of the tet-off transactivator (tTA) 2 Gradinaru 99120 pAAV-ihSyn1-tTA Inducible Synapsin...receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-flex-taCasp3-TEVp EF1a-driven... Tools for Affinity Purification These AAV encode tools for affinity purification (which can be used for...tet-off transactivators and tools for affinity purification (TRAP). Viral... Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell Ablation Tetracycline Transactivators...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...
  14. Viral Production

    Type
    Collection
    ...page for the corresponding catalog item (see maps section for images). Figure 2: AAV Pro cells were transduced...suggests that titers obtained using ddPCR are generally 2–3 fold higher than those achieved using the standard... a new vial of early passage cells. Approximately 2 weeks post-thaw, cell culture supernatant is tested...minimized by using an endotoxin-free plasmid purification protocol. To minimize the immunogenic properties...typically prepared using endotoxin-free plasmid purification kits. Resources Browse lentiviral preps available...
  15. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...variety of modifications in endogenous loci with unprecedented speed and specificity. Figure 2: An overview...transcribed to make the pre-CRISPR RNA (pre-crRNA). (2) The pre-crRNA is processed into individual crRNAs...2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain effector) Type I (Cas3) Type ...regulation of transcription in eukaryotes. Cell . 154(2):442-51. PMID: 23849981 Ishino Y, Shinagawa H, Makino...Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell . 163(3):759-71. PMID: 26422227...development of new applications. The first CRISPR papers described two main categories of genome edits. ... lower off-target cleavage frequency. Truncated gRNAs: Truncated gRNAs display less off-target activity...
  16. Mammalian RNAi Tools

    Type
    Collection
    ...degrades the mRNA. RISC includes argonaute protein 2 (Ago2), which facilitates cleavage of the target. ... International Journal of Biomedical Science, 13 (2), 48–57. PubMed (Link opens in a new window) . Moore...search our full site . ID Plasmid Vector Type PI Publication Additional Resources Addgene Resources pLKO.1...
  17. Zinc Finger Consortium: Zinc Finger Arrays

    Type
    Collection
    ...GUSB OZ551 and OZ552 OPEN OPEN gGTCATCTGCcattcGAGGCGGACa REST corepressor 2 OZ553 and OZ554 OPEN OPEN gCTCACCATCtgttggaTGCGATGGAa...highly efficient gene modification. Maeder ML et al. Mol Cell. . 2008. Jul 25. 31(2):294-301. PubMed PMID...OPEN gAGCATCACCtcgctGGAGGTGAGc PTRF/Cavin1 OZ513 and OZ514 OPEN OPEN gACAGCCGTCtgcatctGGAGGTGCCc pitrm1...OPEN OPEN aGCCATCATCaggttcaGGATGAGCCc Kif6 OZ537 and OZ538 OPEN OPEN aAGCTTCCTCttcattgGCTGACTGCa ldr (low...CODA OPEN cAACCTCAGCATAAAGCTGGAGGAg psen2 OZ577 and OZ578 CODA OPEN cGGCATCTCCAGAGCCCGAGGCGGACc zgc:162148...hydroxylase (dbh) OZ525 and OZ526 OPEN OPEN tCCCATCCTAtcgttGCATGAGCTc mdka (midkine-related growth factor) OZ527...lipoprotein receptor) OZ539 and OZ540 OPEN OPEN tTGCATCCACggcagTCGGCAGTGc Encephalopsin (Opn3) OZ541 and OZ542 OPEN...
  18. Antibody Plasmid Collection

    Type
    Collection
    ...phage display. J Immunol Methods. 2000 Aug 28;242(1-2):159-81. Carlos Barbas Vector system for expression...+J phagemid libraries. Immunol Lett. 2015 Oct;167(2):95-102. Joanna Bereta Sybody Generation Toolbox for...antibodies are produced in-house and undergo application-specific validation and quality control by Addgene...extensively validated for neuroscience research applications from the NeuroMab/Trimmer Lab Recombinant mAb...imaging. Learn more about antibodies and their applications in our Antibody Guide ! Cloning and Expressing...antibodies, and Fc-silent mutants. Functional diversification of hybridoma-produced antibodies by CRISPR/...456(1):527-33. Gavin Wright pET-30-based vector dedicated to efficient scFv expression, which circumvents...
  19. AAVED

    Type
    Collection
    ...Regulation Ben Deverman 2:00 PM Cre-DOG and Combinatorial Strategies Connie Cepko 2:45 PM Break 3:00 PM (...contribute to this publication. Citation information for openly shared communication: Adeno-Associated ...Addgene's 2018 AAV Education and Development (AAVED) workshop series. The... The AAV Education and Development ...Details Date: Friday September 21, 2018, 9 AM - 5 PM Location: Addgene, 75 Sidney St, Cambridge, MA, 02139 Organizing...useful to help improve this technology or its application? What are some current obstacles that researchers...prepare and compile resources for this meeting's publication, we are asking participants to share practical...
  20. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...expressing oncogenes or toxins should be handled at BSL-2. AAV can transduce both dividing and non-dividing ...plasmid, expressing Rep2 and Cap1 Wilson 104963 pAAV2/2 AAV2 AAV packaging plasmid, expressing Rep2 and Cap2...advantage of using AAV for research is that it is replication-limited and typically not known to cause disease...certain exogenous gene products that mediate AAV replication. This requirement has been circumvented with ...expressing Rep2 and PHP.eB Cap controlled by tTA-TRE amplification system Gradinaru 103006 pUCmini-iCAP-PHP.S PHP.S...expressing Rep2 and PHP.S Cap controlled by tTA-TRE amplification system Gradinaru 127847 pUCmini-iCAP-PHP.V1 ...expressing Rep2 and PHP.V1 Cap controlled by tTA-TRE amplification system Gradinaru 175004 pUCmini-iCAP-AAV.CAP-B10...
Showing: 21 - 40 of 77 results