Skip to main content
Addgene
Showing: 21 - 40 of 74 results

  1. Synthetic Biology - Assembly Standards Guide

    Type
    Collection
    ...overview of the most common methods. BioBrick BioBrick-2 BglBrick Silver Standard Freiburg Standard BioBrick...visit iGEM: BioBrick (RFC 10) Back to Top BioBrick BB-2 (RFC 12) Prefix: GAATTC GCGGCCGC T ACTAGT G Prefix...XbaI, SapI For more info, visit iGEM: BioBrick BB-2 (RFC 12) Back to Top BglBrick – Berkeley Standard ...after the promoter, and so on. The following table provides information for the assembly standards most commonly...will need to be reverse complimented for primer design. The restriction enzymes used for assembly are ..., NotI , PstI Scar: GCTAGT Features: 6 bp scar encodes Ala-Ser; Allows for in-frame fusions; NheI is rare...Enzymes: BamHI , Xhol Scar: GGATCT Features: Scar encodes Gly-Ser in-frame with prefix start codon; Employs...

  2. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...transcribed to make the pre-CRISPR RNA (pre-crRNA). (2) The pre-crRNA is processed into individual crRNAs...2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain effector) Type I (Cas3) Type ... with unprecedented speed and specificity. Figure 2: An overview of CRISPR and NHEJ/HDR. The Cas9/gRNA...regulation of transcription in eukaryotes. Cell . 154(2):442-51. PMID: 23849981 Ishino Y, Shinagawa H, Makino...X, Scott DA, Mikkelson T, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F. 2014. Genome-Scale CRISPR-Cas9...Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell . 163(3):759-71. PMID: 26422227...also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The CRISPR revolution shows...

  3. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...Cascade ( C RISPR- as sociated c omplex for a ntiviral de fense) complex, comprised of a combination of Cas5...are largely underutilized compared to their Class 2 counterparts like Cas9. This is attributed in part...Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts Cas3 is a unique member...

  4. CRISPR Guide

    Type
    Collection
    ...M. M., Semenova, E., Severinov, K., De Vos, W. M., Dame, R. T., De Vries, R., Brouns, S. J., & Van Der...is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme activity, experimental...left free to interact with the target DNA. Figure 2: Overview of the NHEJ repair mechanism Cas9 will only...systems enable researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single...Cas9 is included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...your experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with...the presence of infectious organisms (like SARS-CoV-2 ) and genetic mutations. Similar to Cas9 and Cas12...

  5. Lentiviral Prep Service

    Type
    Collection
    ...Barcode Library Version 2 Ready-to-use lentiviral particles carrying version 2 of the CellTag barcoding...barcoding library. Version 2 of the Celltag library contains 4934 barcodes to combinatorially index cells for... Guide to Plasmid Pooled Libraries . ID Name Description Genes/Insert Selection PI Human knockout pooled...2A-Blast-WPRE) Zhang Pooled Barcoding Libraries ID Name Description PI 115643 Morris CellTag Barcode Library Version...Version 1 of the Celltag library contains 19973 barcodes to combinatorially index cells for single-cell...Version 3 of the Celltag library contains 5737 barcodes to combinatorially index cells for single-cell...

  6. CRISPR Plasmids - Double-Strand Break (Cut)

    Type
    Collection
    ...is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme activity, experimental... with 1. homology to the DNA flanking the DSB and 2. a specific edit close to the gRNA PAM site. When ...Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts Fully functional CRISPR...or search the tables below for CRISPR plasmids designed to introduce a DSB. Plasmids are available for...

  7. Validated gRNA Sequences

    Type
    Collection
    ...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below lists gRNA...the particular conditions of the experiment as described in the associated article (listed below by PubMed...

  8. Neurodegeneration Research Collection

    Type
    Collection
    ...different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of individuals develop...study aggregation. Saha et al. Nat Commun. 2023 Feb 2. Study the C terminal domain of TDP-43 to better understand... rodent species. Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 ...with the iPSC toolbox . Lam et al. bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression...brain. The cause of this neuron death is unknown. Despite the idiopathic (having no specific known cause)...scientific community at low cost, with rapid delivery. Includes antibodies, viral vectors, animal models, purified...

  9. TALEN Guide

    Type
    Collection
    ...par with ZF arrays, if not slightly lower. Figure 2: Simplified representation of the Voytas/Bogdanove...variety of backbones in just a few steps ( Figure 2 ). The Bogdanove group also hosts web-based software...mammalian transcription. Nat Biotechnol. 2011 Feb;29(2):149-53. PMID: 21248753 . TALEs for the masses. Rusk...components of the array recognize individual nucleotides. For over ten years, zinc finger (ZF) arrays ...that came out in the spring of 2011, the groups describe a set of customized plasmids that can be used ... a TALEN kit through Addgene. This kit, first described in Nature Biotechnology in August, uses a serial...in Nature Biotechnology early in 2011 and they described their kit for assembling TAL effector arrays in...

  10. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...Layer 2-3_IT Isocortex 230803 pAAV-AiE2638m-minBG-iCre(R297T)-BGHpA AiP20142 AiE2638m Cre Layer 2-3_IT ...Layer 2-3_IT Isocortex 220727 pAAV-AiE2543m-minBG-iCre(R297T)-BGHpA AiP2048 AiE2543m Cre Layer 2-3_IT ...Layer 2-3_IT Isocortex 230402 pAAV-AiE0680m-minBG-iCre(R297T)-BGHpA AiP15072 AiE0680m Cre Layer 2-3_IT ...populations using systemic AAV delivery. The collection includes the top vectors with the highest specificity and...

  11. AAV Molecular Tools

    Type
    Collection
    ...constitutive Expression of the tet-off transactivator (tTA) 2 Gradinaru 99120 pAAV-ihSyn1-tTA Inducible Synapsin...receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-flex-taCasp3-TEVp EF1a-driven...Cre-dependent Cre-dependent, bicistronic expression of designer pro-taCasp3 and TEVp for studying cell ablation...

  12. Mammalian RNAi Tools

    Type
    Collection
    ...sequence and RISC cleaves and degrades the mRNA. RISC includes argonaute protein 2 (Ago2), which facilitates... International Journal of Biomedical Science, 13 (2), 48–57. PubMed (Link opens in a new window) . Moore...RISC). RISC unwinds the double-stranded siRNA and degrades one of the strands. The remaining single-stranded... binding of RISC. For more information on shRNA design and delivery, see resources below. Figure 1: Overview... Trono Lab Lentivectors Toolbox Optimized shRNA design in pSico with pSicoligomaker (Andrea Ventura lab...Taxman, D. J. (2010). Short hairpin RNA (shRNA): design, delivery, and assessment of gene knockdown . Methods...

  13. Viral Production

    Type
    Collection
    ...suggests that titers obtained using ddPCR are generally 2–3 fold higher than those achieved using the standard...catalog item (see maps section for images). Figure 2: AAV Pro cells were transduced with either pAAV-Ef1a-mCherry-IRES-Cre... a new vial of early passage cells. Approximately 2 weeks post-thaw, cell culture supernatant is tested...protocols, titering methods, and quality control are described below. AAV Production AAV distributed by Addgene...

  14. Adenovirus Plasmids

    Type
    Collection
    ...recombining shuttle plasmids Vogelstein 16401 pAdEasy-2 Adenoviral For recombining shuttle plasmids; for use with...transgene under CMV promoter Vogelstein 16407 pAdEasy 2-GFP beta-gal Shuttle Test plasmid that contains β-...strains for generating adenovirus. ID Strain Description PI 16398 BJ5183 Strain for recombination between... plasmids that have inserts. ID Plasmid Type Description PI 16400 pAdEasy-1 Adenoviral For recombining... be assembled in a one-tube reaction. ID Kit Description PI 1000000176 AdenoBuilder toolkit Plasmids contain...

  15. Antibody Plasmid Collection

    Type
    Collection
    ...phage display. J Immunol Methods. 2000 Aug 28;242(1-2):159-81. Carlos Barbas Vector system for expression...+J phagemid libraries. Immunol Lett. 2015 Oct;167(2):95-102. Joanna Bereta Sybody Generation Toolbox for...create and express plasmid-based antibodies. Description Article PI One-step assembly of antibody heavy...for "anti-mouse" or "anti-rabbit") ID Plasmid Description Gene/Insert PI Return to top Do you have suggestions...

  16. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...expressing oncogenes or toxins should be handled at BSL-2. AAV can transduce both dividing and non-dividing ...plasmid, expressing Rep2 and Cap1 Wilson 104963 pAAV2/2 AAV2 AAV packaging plasmid, expressing Rep2 and Cap2... are used in conjunction with the plasmid that encodes the viral genome (typically called cis -plasmid...plasmid). Helper Plasmid ID Plasmid Serotype Description PI 112867 pAdDeltaF6 All Helper plasmid for AAV...Packaging Service at Addgene ID Plasmid Capsid Description PI 112862 pAAV2/1 AAV1 AAV packaging plasmid,...

  17. Optogenetics AAV Preps

    Type
    Collection
    ...Constitutive 1, 2, 5, 9 Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn ChR2/H134R EYFP Constitutive 1, 2, 5, 9....WPRE.SV40 CAG ChR2/H134R mCherry Constitutive 1, 2, 5, 9 Deisseroth 127090 pAAV-CAG-DIO-ChR2(H134R)-eYFP...ChrimsonR (soma-targeted) mRuby2 Cre dependent 9 Adesnik 124603 pAAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40... ChroME (soma-targeted) mRuby3 Cre dependent 9 Adesnik 124651 pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 CaMKII...eGtACR1 (soma-targeted) mRuby3 Cre dependent 9 Adesnik 137155 pAAV-nEF-Con/Fon-iC++-EYFP nEF iC++ EYFP...

  18. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...referred to as intermolecular or bimolecular FRET) or (2) conformational changes within a protein where the...standard consisting of ECFP and EYFP connected by 2 GGSGGS repeats pET28CLY3 Peptide linker standard consisting...fluorescent protein. Plasmid Color Expression Description pPROEX Aqua Cyan Bacterial Expresses Aquamarine...

  19. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ...is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme activity, experimental...Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts To make targeted epigenetic...catalytically dead dCas9 to epigenetic modifiers. Design your gRNA to target a specific promoter or enhancer...

  20. CRISPR Plasmids - Repress Gene Expression

    Type
    Collection
    ...is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme activity, experimental...Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts Catalytically dead dCas9...gene expression by interfering with transcription. Design your gRNA to target your gene of interest’s promoter...
Showing: 21 - 40 of 74 results