We narrowed to 33 results for: vent
-
TypeCollection...plasmids that facilitate detection of genome-editing events. Developed in Craig Mello's lab and described in...
-
Adeno-associated virus (AAV) Plasmids
TypeCollection...mediate AAV replication. This requirement has been circumvented with “helper-virus free systems,” which enable... -
Lentiviral Prep Service
TypeCollection...receive a ready-to-use viral preparation from the inventory below. Lentiviruses are distributed as purified... -
Viral Production
TypeCollection... had a case of mycoplasma contamination. In the event of contamination, all of the virus produced in the... -
Control AAV Preps
TypeCollection...Karpova and Schaffer labs. See the Retrograde AAV Inventory Page . Don’t See What You’re Looking For? Our ... -
Lentivirus Plasmids
TypeCollection...Modification of pLL3.7; Genetic elements known to prevent epigenetic silencing were added; Expresses shRNA... -
Optogenetics AAV Preps
TypeCollection...Karpova and Schaffer labs. See the Retrograde AAV Inventory Page . Don’t See What You’re Looking For? Our ... -
CRISPR History and Development for Genome Engineering
TypeCollection...employ varied mechanisms to block CRISPR. Some prevent the CRISPR-Cas complex from binding to DNA. Others... -
Biosensor AAV Preps
TypeCollection...Karpova and Schaffer labs. See the Retrograde AAV Inventory Page . Don’t See What You’re Looking For? Our ... -
Penn Vector Core Partnership with Addgene
TypeCollection...Addgene's viral vectors See Addgene's Current AAV inventory , which includes all viral vectors transferred... -
Validated gRNA Sequences
TypeCollection...Eml M. musculus 64071 cut S. pyogenes 25337876 Ventura Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG ... -
Antibody Guide
TypeCollection...block the membrane to remove excess antibody and prevent unwanted binding. Incubate the membrane with a ... -
Trimmer Lab NeuroMab Collection
TypeCollection...that they are a distinct IgG subclass from the conventional mAb to facilitate multiplex labeling with subclass-specific...