Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 88 results for: IRE

Showing: 21 - 30 of 88 results

  1. Plasmids for Stem Cell Research

    Type
    Collection
    ...and study of stem cells, from iPSC generation to directed differentiation....the body and have the capacity to give rise to an entire organism. iPSC technology removes the possible ...below. Once iPSCs have been created they can be directly differentiated into specific somatic stem cells...Plasmids below. Alternatively, it is also possible to directly differentiate one differentiated somatic cell ...endogenously-tagged gene variants or browse Addgene’s entire collection of Stem Cell Research Plasmids . For...lentiviral plasmids A drug-inducible system for direct reprogramming of human somatic cells to pluripotency...Highly Efficient Reprogramming to Pluripotency and Directed Differentiation of Human Cells with Synthetic ...

  2. Antibody Guide

    Type
    Collection
    ...antibodies? Will you be using a direct or indirect detection method? If indirect, do you already have secondary...signal amplification through the indirect detection method. In the direct detection method, the signaling...most common types of ELISAs are direct or sandwich ELISAs. For direct ELISAs, an antigen or protein of...antibody methods, it can be done using either an indirect or direct method. Since IF uses fluorophore color to...cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires single-antibody...complex. Due to their increased manufacturing requirements, monoclonal antibodies are typically more expensive... Polyclonal antibodies are typically collected directly from animals and contain antibodies targeting ...

  3. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...technique creates diverse populations of mutants for directed evolution. ID Plasmid Gene/Insert Promoter Selectable...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...

  4. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...

  5. Brain Armamentarium

    Type
    Collection
    ...Alias: CN4361) Expression of jGCaMP8s in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...Alias: CN4360) Expression of jGCaMP8s in striatal direct pathway medium spiny neurons (D1 MSNs) Jonathan...: CN4035) Expression of CoChR-EGFP in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...Alias: CN4033) Expression of CoChR-EGFP in striatal direct pathway medium spiny neurons (D1 MSNs) Jonathan...Alias: CN3987) Expression of jRGECO1a in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...AAV for Cre recombinase expression in striatal indirect pathway D2-MSNs Jonathan Ting Viviana Gradinaru... AAV for Cre recombinase expression in striatal direct pathway D1-MSNs Jonathan Ting Viviana Gradinaru...

  6. Genetic Code Expansion

    Type
    Collection
    ... 105829 pIRE4-Azi Azi-tRNA synthetase (EAziRS) p-Azido-phenylalanine (Azi) Mammalian TAG Irene Coin 105830...biologists have expanded the genetic code by redirecting specific codons to encode amino acids beyond ...E.coli and can be mutated and screened through directed evolution to charge the tRNA with a different ...-like click amino acids, tRNA M15 Mammalian TAG Irene Coin 113644 pRF0G-Tyr tyrosyl-tRNA synthetase M....182653 pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA Y306A/Y384F (AF) pyrrolysine (Pyl) tRNA.... Expresses yeast TrpRS/tRNA pair instead. For directed evolution of the liberated EcTrpRS/tRNA pair to...

  7. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...contains a special Protospacer Adjacent Motif (PAM) directly after where the crRNA would bind. (5) After the...double-strand break (DSB) induced by Cas9 could be repaired through non-homologous end joining (NHEJ) , an...homology arms was supplied, the break could be repaired according to this template, allowing for precise...tags, or loxP/FRT sites, among others. Homology-directed repair (HDR) allows us to create a variety of ...occurred at a truly astonishing pace, with work directed towards increasing on-target editing rates and...cuts only one strand of DNA and can be used with paired gRNAs to lower off-target cleavage frequency. Truncated...rely on NHEJ or HDR: Base editors : Base editors directly convert bases without creating a double-strand...

  8. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...

  9. Validated gRNA Sequences

    Type
    Collection
    ...25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661 Fire dpy‐10 C....25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA 59928 cut S. pyogenes 25161212 Fire rde-1(H974...pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT 60212 cut S. pyogenes 25161212 Fire sv40 promoter...CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG 65630 cut ...GATAAATGAGCATAATGAAC 59929 cut S. pyogenes 25161212 Fire rgs4 D. rerio GGAGAAGGTGAAGGACACTG 42246 cut S. ...GTGAGACGTCAACAATATGG 59930 cut S. pyogenes 25161212 Fire Rosa26 M.musculus ACTCCAGTCTTTCTAGAAGA 64216 cut...GGAACTCGTGTCAAAACAAC 59932 cut S. pyogenes 25161212 Fire unc-119 C. elegans GAATTTTCTGAAATTAAAGA 46169 cut...

  10. Viral Vectors

    Type
    Collection
    ...genome directs the production of more viruses. However, in theory, a viral genome could direct the host... of their mild immunogencity. These viruses can direct long-term transgene expression, but generally are...Adenoviruses have high transduction efficiency and direct high but transient transgene expression. γ-Retrovirus...molecules or to express other genes. Viruses used to direct these alternate functions simply have to harbor...array of viral genomes, enabling researchers to direct a wide array of genetic functions in cells. For... through the removal of certain genes that are required for viral replication. Thus, as a safety feature...occurring viruses do. Instead, the genes that are required for viral replication are usually divided among...
Showing: 21 - 30 of 88 results