...concentration is confirmed by Coomassie staining. For Coomassie staining, the sample is separated via a denaturing...formulation buffer is phosphate-buffered saline containing 1 mM sodium azide. This buffer is not compatible...

...Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin Adherens junctions 107579 RAB5A-mEGFP AICSDP-39...stress granules 114411 TNNI1-mEGFP AICSDP-34 mEGFP Troponin I, slow skeletal type Sarcomeric thin filaments...Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks 124608 NPM1-mTagRFP-T AICSDP...

...activating factor 1 ATM ATM serine/threonine kinase ATR ATR serine/threonine kinase B99 G-2 and S-phase expressed...PIRH-2 Ring finger and CHY zinc finger domain containing 1 (RCHY1); E3 ubiquitin protein ligase PTEN Phosphatase...

...suited to simplify the cloning process as it can be used in blue-white screening and forms blue colonies...promoter. WPRE has been removed to increase the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express...

...Synthetic CGAAATGAGAAAGGGAGCTACAAC 47869 cut N. meningitidis 23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG...GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer A Synthetic TACCATCTCAAGCTTGTTGA...TACCATCTCAAGCTTGTTGA 48651 cut N. meningitidis 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N... N. meningitidis 24076762 Church Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus...

...choice (Fig. 1B) . Thus, through standard plasmid cloning, viruses can be engineered to harbor a wide array...easily modified and amplified (through standard cloning methods). There are different types of viruses ...your institution’s Biosafety Committee before beginning virus work. For general virus biosafety guidelines...

...collection include polymerase chain reaction (PCR), cloning, isothermal amplification, reverse transcription...the basis of manufacturing their own enzymes by cloning them into an expression vector of their choice ...Plasmids Jennifer Molloy Lab Plasmids Golden Gate cloning...

... enable us to purify specific genomic regions retaining molecular interactions and identify molecules ...specific genomic regions of interest 85586 gRNA Cloning Vector Bbs I ver. 2 An empty sgRNA expression vector...Efficient isolation of specific genomic regions retaining molecular interactions by the iChIP system using...

...plasmid and is not compatible with other plasmids containing high copy ColE1/PUC-like origins. Therefore, ...at the central position. Introducing Hi-P for screening phosphorylation-dependent protein-protein interactions...NEDD4-2; 111705-8 ) is available from Addgene. Screening kinases. The mode #1 phosphosite library can also...

...fibrosis, atherosclerosis, and carcinogenesis. The defining feature of the KLF family is the presence of three...resource on Addgene. If you have created plasmids containing KLF, we encourage you to contribute to this community...

...extracellular signal-regulated kinases (ERKs), are serine/threonine-specific protein kinases. They regulate diverse...collection for community. If you have created plasmids containing MAPK and would like to add to this collection...

...background information on CRISPR and the basics for planning your first CRISPR experiment. CRISPR 101 eBook...libraries are a powerful tool for genome-wide screening. Purify dCas9 fused to an epitope tag can be used...

...directions from the target region, effectively turning Cas3 into a DNA “shredder” system that can cause... a boundary defined by anti-CRISPR proteins or running into other proteins bound to DNA, and the break...

...Cui, L., Bikard, D., & Van Teeffelen, S. (2018). Tuning dCas9’s ability to block transcription enables ...Dodd, I. B., & Shearwin, K. E. (2013). One-Step cloning and chromosomal integration of DNA. ACS Synthetic...

...flavors of activators were constructed, with VP48 containing 3x minimal VP16 domains, VP64 with 4, VP96 with...] + sgRNA expression vector or the linear DNA containing the sgRNA expressing fragment produced by PCR...

...window) External Collaboration Results in Student Learning Gains and Positive STEM Attitudes in CUREs. Callahan...undergraduate research experiences (CURE) impacts student learning and attitudinal outcomes: A study of the Malate...

...description: Avidity based Extracellular Interaction Screening (AVEXIS) for the scalable detection of low affinity.... Genome biology 2009; 10(9):R99. Large-scale screening for novel low-affinity extracellular protein interactions...

...pMSCV PIG (Puro IRES GFP empty plasmid) MSCV For cloning and gene expression; select with puromycin or screen...pMSCV-IRES-mCherry FP MSCV A bicistronic IRES-mCherry containing retroviral plasmid Vignali 27995 TtRMPVIR CMV...

...Technology SNAP-tag SNAP-tag is based on the human O6-alkylguanine-DNA-alkyltransferase (hAGT), a DNA repair protein... but reacts with benzylcytosine rather than benzylguanine derivatives to allow for dual labeling and visualization...

...Sensors dLight RdLight GRAB_DA GRAB_rDA GRAB_gDA Serotonin Sensors psychLight iSeroSnFR GABA Sensors iGABASnFR...pAAV-hSyn-GRAB-gDA3m Syn GRAB_gDA3m none Constitutive 1 Li Serotonin Sensors 128485 pAAV-CAG-iSeroSnFR-Nlgn CAG iSeroSnFR...