...suffix sequences are given for the coding strand , meaning that the suffix will need to be reverse complimented...should be avoided whenever possible. Other popular cloning strategies for the assembly of synthetic parts ...systems such as MoClo . Check out our Molecular Cloning Techniques Guide for an overview of the most common...

...concentration is confirmed by Coomassie staining. For Coomassie staining, the sample is separated via a denaturing...formulation buffer is phosphate-buffered saline containing 1 mM sodium azide. This buffer is not compatible...

... however, increases indel formation slightly. Designing the sgRNA with a spacer that only binds the edited...of gRNA (e.g., pegRNA, epegRNA, nicking sgRNA), cloning enzyme, selectable marker, and whether the plasmid...Plasmid Expression System Promoter Guide RNA Type Cloning Enzyme Co-expressed Cas9 Selection PI pU6-pegRNA-GG-acceptor...

...Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin Adherens junctions 107579 RAB5A-mEGFP AICSDP-39...stress granules 114411 TNNI1-mEGFP AICSDP-34 mEGFP Troponin I, slow skeletal type Sarcomeric thin filaments...Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks 124608 NPM1-mTagRFP-T AICSDP...

...activating factor 1 ATM ATM serine/threonine kinase ATR ATR serine/threonine kinase B99 G-2 and S-phase expressed...PIRH-2 Ring finger and CHY zinc finger domain containing 1 (RCHY1); E3 ubiquitin protein ligase PTEN Phosphatase...

...suited to simplify the cloning process as it can be used in blue-white screening and forms blue colonies...promoter. WPRE has been removed to increase the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express...

...collection include polymerase chain reaction (PCR), cloning, isothermal amplification, reverse transcription...the basis of manufacturing their own enzymes by cloning them into an expression vector of their choice ...Plasmids Jennifer Molloy Lab Plasmids Golden Gate cloning...

...choice (Fig. 1B) . Thus, through standard plasmid cloning, viruses can be engineered to harbor a wide array...easily modified and amplified (through standard cloning methods). There are different types of viruses ...your institution’s Biosafety Committee before beginning virus work. For general virus biosafety guidelines...

...Synthetic CGAAATGAGAAAGGGAGCTACAAC 47869 cut N. meningitidis 23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG...GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer A Synthetic TACCATCTCAAGCTTGTTGA...TACCATCTCAAGCTTGTTGA 48651 cut N. meningitidis 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N... N. meningitidis 24076762 Church Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus...

... enable us to purify specific genomic regions retaining molecular interactions and identify molecules ...specific genomic regions of interest 85586 gRNA Cloning Vector Bbs I ver. 2 An empty sgRNA expression vector...Efficient isolation of specific genomic regions retaining molecular interactions by the iChIP system using...

...plasmid and is not compatible with other plasmids containing high copy ColE1/PUC-like origins. Therefore,...at the central position. Introducing Hi-P for screening phosphorylation-dependent protein-protein interactions...NEDD4-2; 111705-8 ) is available from Addgene. Screening kinases. The mode #1 phosphosite library can also...

...fibrosis, atherosclerosis, and carcinogenesis. The defining feature of the KLF family is the presence of three...resource on Addgene. If you have created plasmids containing KLF, we encourage you to contribute to this community...

...Plasmodium vivax merozoite protein plasmids for screening protein interactions...collection of plasmids that was created for systematic screening of extracellular protein interactions to identify...

...demonstrated the use of these vectors to efficiently modify nine different target sites in endogenous zebrafish genes...Specific gRNA expression plasmids can be built by cloning a pair of annealed oligonucleotides (each 26 nts...

...extracellular signal-regulated kinases (ERKs), are serine/threonine-specific protein kinases. They regulate diverse...collection for community. If you have created plasmids containing MAPK and would like to add to this collection...

...Oldewurtel E, Cui L, Bikard D, van Teeffelen S. Tuning dCas9’s ability to block transcription enables ...found in this article: St-Pierre et al., One-Step Cloning and Chromosomal Integration of DNA, ACS Synthetic...

...receptor proteins for use with AVEXIS interaction screening... erythrocytes that was created for systematic screening of extracellular protein interactions to identify...

...background information on CRISPR and the basics for planning your first CRISPR experiment. CRISPR 101 eBook...libraries are a powerful tool for genome-wide screening. RNA Targeting gRNAs RNA Targeting Type VI CRISPR...

...list of EXPRESs plasmids used with AVEXIS for screening in Plasmodium falciparum....collection of plasmids that was created for systematic screening of extracellular protein interactions to identify...

...flavors of activators were constructed, with VP48 containing 3x minimal VP16 domains, VP64 with 4, VP96 with...] + sgRNA expression vector or the linear DNA containing the sgRNA expressing fragment produced by PCR...