Skip to main content
Addgene

We narrowed to 10 results for: Atm

Showing: 1 - 10 of 10 results
  1. p53 Pathway

    Type
    Collection
    ...Apaf-1 Apoptotic peptidase activating factor 1 ATM ATM serine/threonine kinase ATR ATR serine/threonine...
  2. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...-His-ATM wt ATM His, Flag CMV Ataxia telangiectasia Michael Kastan 31986 pcDNA3.1(+) Flag-His-ATM kd ATM... Martins 14542 pLV.ATMi ATM H1 Ataxia telangiectasia Didier Trono 14581 pSUPER.ATMi ATM H1 Ataxia telangiectasia...173579 Lenti-sgAtm#1/Cre ATM CMV Ataxia telangiectasia Charles Swanton 173580 Lenti-sgAtm#2/Cre ATM CMV Ataxia... ATM His, Flag CMV Ataxia telangiectasia Michael Kastan 32300 hATMS1981A ATM His, Flag CMV Ataxia telangiectasia...Daley 36805 TAL2402 ATM Flag, FOKI CMV Ataxia telangiectasia Keith Joung 36806 TAL2403 ATM Flag, FOKI CMV ...APOE Alzheimer's Sohail Tavazoie 43908 pcDNAFLAG-ATM-kd ATM Flag, His CMV Ataxia telangiectasia Stephen Elledge...Lewy body dementia Tiago Outeiro 89643 Lenti-sgAtm/Cre ATM U6 Ataxia telangiectasia Monte Winslow 89755...
  3. Validated gRNA Sequences

    Type
    Collection
    ...TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall ATM H. sapiens TGAATTGGGATGCTGTTTTT 58779 cut S. pyogenes...
  4. Genetic Code Expansion

    Type
    Collection
    ...non-hydrolyzable phosphoserine Ryan Mehl 218768 ATMW1 Removed endogenous EcTrpRS/ttRNA pair (knocked out...derived from EcNR1 strain) Abhishek Chatterjee 218769 ATMW-BL21 Removed endogenous EcTrpRS/ttRNA pair (knocked...derived from BL21 strain) Abhishek Chatterjee 218770 ATMY1 Removed endogenous EcTyrRS/tRNA pair (tyrS gene ...derived from EcNR1 strain) Abhishek Chatterjee 218771 ATMY3 Removed endogenous EcTyrRS/tRNA pair (tyrS gene ...derived from EcNR1 strain) Abhishek Chatterjee 218772 ATMY4 Removed endogenous EcTyrRS/tRNA pair (tyrS gene ...derived from EcNR1 strain) Abhishek Chatterjee 218773 ATMY5 Removed endogenous EcTyrRS/tRNA pair (tyrS gene ...derived from EcNR1 strain) Abhishek Chatterjee 218774 ATMY-C321 Removed endogenous EcTyrRS/tRNA pair (tyrS ...
  5. NETRF

    Type
    Collection
    ...research to discover cures and more effective treatments for carcinoid, pancreatic, and related neuroendocrine...in accelerating progress in the diagnosis and treatment of neuroendocrine cancers. As such, NETRF strongly...
  6. Neurodegeneration Research Collection

    Type
    Collection
    ... no cure or way to prevent progression of PD. Treatment consists mainly of managing symptoms through medication...discovery and advance development of diagnostics and treatments for Alzheimer’s disease and related disorders...
  7. Rett Syndrome

    Type
    Collection
    ... launched in 2008 to drive the development of treatments and cures for Rett Syndrome and related MECP2...
Showing: 1 - 10 of 10 results