Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 41 - 48 of 48 results

  1. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...113584 (EFS) 113585 (TBG) Knockout Mouse Chen N/A (AAV) 4 286 Mouse Validation (mVAL) CRISPR Library 159391...

  2. Plasmids for Stem Cell Research

    Type
    Collection
    ...Jun 6. Buganim Glial Cells Retinal Ganglion Cells AAV/CRISPR Mouse Glia-to-Neuron Conversion by CRISPR-...

  3. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...-FP Plasmid Type Mammalian, non-viral Lentiviral AAV Retroviral Bacterial Yeast Other Promoter CMV T7 ...74170 pVEX-CC1 DCTN1 tac ALS Trina Schroer 75437 p-AAV-sh[SNCA] SNCA U6 Parkinson's Edward Burton 75637 ...Parkinson's Hilal Lashuel 36055 pAAV asyn WT SNCA CMV Parkinson's Hilal Lashuel 36056 pAAV asyn S87A SNCA CMV Parkinson's...Hilal Lashuel 36066 pAAV asyn S129A SNCA CMV Parkinson's Patrick Aebischer 36067 pAAV asyn S129G SNCA CMV...Hilal Lashuel 36068 pAAV asyn S129E SNCA CMV Parkinson's Hilal Lashuel 36069 pAAV asyn S129D SNCA CMV ...Aebischer 36070 pAAV asyn S87A/S129A SNCA CMV Parkinson's Patrick Aebischer 36071 pAAV asyn S87D/S129A...Lashuel 107543 pAAV-AICD-NLS-IRES-hrGFP APP CMV Alzheimer's Hélène Marie 107544 pAAV-AICD-NES-IRES-hrGFP...

  4. Validated gRNA Sequences

    Type
    Collection
    ...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...23287722 Church AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens... 26997482 Yeo AAVS1 H. sapiens TGTCCCTAGTGGCCCCACTG cut S. pyogenes 26789497 Corn AAVS1 H. sapiens ACAGTGGGGCCACTAGGGAC...GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758 Sabatini AAVS1 H. sapiens GTCCCCTCCACCCCACAGTG 41817 cut S. pyogenes...GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 72833 cut S. pyogenes...

  5. CRISPR Plasmids - Tagging

    Type
    Collection
    ...targeting the AAVS1 locus. Doyon Tagging Plasmid: 3xFLAG-2xSTREP Construct for integrating at the AAVS1 "safe ...cloned directly into this vector and targeted to the AAVS1 genomic safe harbor locus using untagged SpCas9 ...Addgene 41815 or #44719 ) in combination with gRNA_AAVS1-T2 (Addgene #41818) or using an all in one vector...vector from the Doyon lab, eSpCas9(1.1)_No_FLAG_AAVS1_T2 (Addgene #79888) , which expresses an untagged...safe harbor" locus: eSpCas9(1.1)_No_FLAG_AAVS1_T2 Doyon Lab TAP Tagging Protocol 97.2 KB Yamamoto PITCh Tagging...

  6. Church Lab CRISPR Plasmids

    Type
    Collection
    ...cut DNA 41817 gRNA_AAVS1-T1 A gRNA to human AAVS1 41818 gRNA_AAVS1-T2 A gRNA to human AAVS1 41819 gRNA_GFP-T1...

  7. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP NA Cytoplasm 101781 CETN2-...mEGFP Ras-related protein Rab-5A Endosomes 107580 AAVS1-mTagRFPT-CAAX AICSDP-42 mTagRFPT CAAX domain of ...AICSDP-29 mTagRFPT Lamin B1 Nuclear envelope 114404 AAVS1-mEGFP (PGK) AICSDP-36 mEGFP NA Cytoplasm 114405 ...
Showing: 41 - 48 of 48 results