Skip to main content

We narrowed to 18 results for: Des

Showing: 1 - 18 of 18 results
  1. Science Guides

    Type
    Guide
    ...Collection of guides that describe how popular scientific techniques work... Science Guides Addgene has created... created the following guides to help you start learning about various scientific concepts related to ...to our plasmid collection. Find links to the guides below. Antibodies Chemogenetics CRISPR Optogenetics... sets. Read More Viral Vectors Find educational guides to learn more about the different types of viruses...
  2. Addgene's eBook Collection

    Type
    Guide
    ...First Edition, trans. About Una traducción al español de nuestro libro electrónico, CRISPR 101. Close About... tips for planning your CRISPR experiment and designing your gRNA and how to use pooled libraries in genome-wide...November 2018 | First Edition About The guide includes information on the many career options in science...
  3. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Retroviral Vector Design. In Retroviruses . Cold Spring Harbor Laboratory Press. NIH Bookshelf De Ravin, S. S...PMID: 24501411 Gilroy, K. L., Terry, A., Naseer, A., De Ridder, J., Allahyar, A., Wang, W., Carpenter, E.... Science Guides Viral Vectors Gamma-Retroviral Vector Guide Gamma-Retroviral...been widely used in the research community for decades. Wildtype gamma-retroviruses have been engineered...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...lentiviral packaging methods . The three plasmids described above (envelope, packaging, and transfer) are ...into the HEK293T packaging cell line. This system provides the greatest flexibility to pseudotype gamma-retrovirus...
  4. CRISPR Guide

    Type
    Guide
    ...M. M., Semenova, E., Severinov, K., De Vos, W. M., Dame, R. T., De Vries, R., Brouns, S. J., & Van Der...Cascade ( C RISPR- as sociated c omplex for a ntiviral de fense) complex to initiate DNA degradation. Cascade...Cascade C RISPR- as sociated c omplex for a ntiviral de fense; a complex of multiple Cas enzymes including...Han, Y., Ogrodowski, P., Crippa, A., Rekhtman, N., De Stanchina, E., Lowe, S. W., & Ventura, A. (2014)...., Boix, C., Perrouault, L., Tesson, L., Geny, S., De Cian, A., Itier, J. M., Anegon, I., Lopez, B., Giovannangeli...application (see: gRNA Design Software ). In addition to an optimized gRNA design, engineered Cas9s can... the desired HDR-edited allele. Therefore, it is important to confirm the presence of the desired edit...
  5. Chemogenetics Guide

    Type
    Guide
    ... Guettier, J. M., Gautam, D., Scarselli, M., Ruiz de Azua, I., Li, J. H., Rosemond, E., Ma, X., Gonzalez...less than ideal. DREADDs Designer Receptors Exclusively Activated by Designer Drugs (DREADDs), like RASSLs..., J. (2012). Design and functional characterization of a novel, arrestin-biased designer G protein-coupled... Science Guides Chemogenetics Guide Chemogenetics Guide Jump To.... Other molecules, including Compound 21, deschloroclozapine (DCZ), perlapine, and olanzapine, have all...bidirectional control of neuronal activity. Table 1: Descriptions of DREADDs and their activity in neurons DREADD...their effect, and outcome in neurons. Table 2: Descriptions of PSAMs and their activity in neurons PSAM ...
  6. Plan Your Experiment

    Type
    Guide
    ...used for gRNA design. Read more about how to design your gRNA . Synthesize and Clone Desired gRNAs Once ...multi-plasmid SAM system Activate Design and Clone Your gRNA Achieving your desired edit comes down to location...on proper gRNA design. While there are some cases where it makes sense to manually design a gRNA, in most...most cases gRNA design software is better and more efficient at designing potential gRNAs for you to choose...selected, it’s time to design your gRNA oligos and clone them into your desired vector. In many cases,...experiment, including selecting the edit type, designing and cloning a gRNA, delivering Cas and the gRNA... Science Guides CRISPR Guide Plan Your Experiment Plan Your CRISPR Experiment...
  7. Optogenetics Guide

    Type
    Guide
    ... Science Guides Optogenetics Guide Optogenetics Guide Jump To: ...cell membrane. Microbial opsins, such as those described below, can be targeted and expressed in specific...natural KCRs have been identified in Hyphochytrium catenoides (HcKCRs) and Wobblia lunata (WiChR). Other Opsin-based...Opsin-based Tools OptoXRs GPCRs activate signaling cascades driving a variety of physiological processes in...Channelrhodopsins from Chlamydomonas reinhardtii Name Description Peak excitation λ (nm) ChR2 Widely used light-gated...variant of CrChR2 590 Other Channelrhodopsins Name Description Peak excitation λ (nm) VChR1 Red-shifted channelrhodopsin..., light-gated K + channels from Hyphochytrium catenoides 540 (HcKCR1) 490 (HcKCR2) WiChR Kalium channelrhodopsin...
  8. Molecular Biology Reference

    Type
    Guide
    ...pairs with G. The order of nucleotides makes up the genetic code and provides the instructions to make ...thymine in RNA molecules. Every 3 nucleotides (codons) in a DNA sequence encodes for an amino acid. The genetic...double-stranded helix. To create the double helix, the nucleotides on the opposing strands of DNA form hydrogen ...acids. Each amino acid is encoded for by three nucleotides, termed a codon. There are 64 codon combinations... for codon-amino acid pairs. Over the past two decades, researchers have also expanded the genetic code...General structure of a plasmid. Plasmid Element Description Origin of Replication ( ori ) DNA sequence which... prior to use in an experiment. Plasmid Type Description Addgene Resource(s) Cloning Plasmids Used to ...
  9. Antibody Guide

    Type
    Guide
    ... is described in more detail in the Multiplex Assays section below. The following table describes the ... Science Guides Antibody Guide Antibody Guide View Addgene's Antibody...of B cells isolated from animals immunized as described above are used to create hybridomas, which produce...each antibody has two binding sites. Isotype Description Configuration and Valency Subclasses IgA Prevalent... used to quantify relative amounts of protein. Includes: Western blot ELISA Capture - used to isolate ...isolate specific proteins or protein complexes. Includes: Immunoprecipitation (IP) Chromatin immunoprecipitation...Visualization - used to visualize protein location. Includes: Immunofluorescence (IF) Immunohistochemistry ...
  10. Lentiviral Vector Guide

    Type
    Guide
    ... Interchangeable; usually encodes for VSV-G Interchangeable; usually encodes for VSV-G Safety Safe; replication...integration of the barcodes, which can then be inherited by daughter cells. Inheritance of the barcodes makes lentiviral... Science Guides Viral Vectors Lentiviral Vector Guide Lentiviral...been widely used in the research community for decades. Wild-type lentiviruses have been engineered into...ONLY by a second-generation packaging system that includes the tat gene Can be packaged by both second- and...and eliminates the requirement for Tat. Always includes deletion in the 3' LTR for self-inactivation LTR...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...
  11. Modular Cloning Guide

    Type
    Guide
    ...Yamamoto Nine pFUS array vectors and destination vectors designed for use with the Golden Gate TALEN and...functional genetic circuit. Level 2 vectors are often designed with flexibility to allow for additional iterations...MoClo kits in our collection. Kit name Type PI Description MoClo Toolkit Plant Expression Sylvestre Marillonnet...chloroplast-specific genetic modules, including destination vectors specific for tobacco ( N. tabacum ) or...nonfunctional "dummy" parts, 34 backbones, and 6 destination vectors for use in E. coli for a variety of applications...rapid one-pot, multipart assembly, combinatorial design and expression tuning in E. coli . CIDAR MoClo ...Bacterial Expression Richard Murray 110 plasmids designed to quickly and efficiently build a wide variety...
  12. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... Science Guides Viral Vectors AAV Vector Guide Adeno-Associated...inverted terminal repeats (ITRs). The Rep region encodes four non-structural replication proteins (Rep78...replication and viral packaging. The Cap region encodes three structural capsid proteins or viral proteins...cargo into cells. Recombinant AAV constructs are designed by replacing the Rep and Cap regions between the...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...new window) Kwon, I., & Schaffer, D. V. (2008). Designer gene delivery vectors: molecular engineering and...., Schaffer, D. V., & Karpova, A. Y. (2016). A designer AAV variant permits efficient retrograde access...
  13. Guide to Using Pooled Libraries

    Type
    Guide
    ... Science Guides Plasmid Pooled Libraries Guide to Plasmid Pooled...less than a hundred plasmids to millions. A well-designed screen can help you begin to understand what genes...important to a certain phenotype, and allow you to design additional hypothesis-directed experiments. Barcoding... barcode, used to mark individual cells. These barcodes will then be inherited by any daughter cells, ...screening experiments, due to the relative ease of designing gRNAs and the ability to modify virtually any ...genes in one experiment. These libraries may be designed to target all the genes in the genome of an organism...libraries: Knockout : CRISPR knockout libraries are designed to create insertions or deletions in targeted ...
  14. Molecular Cloning Techniques

    Type
    Guide
    ...for it to then be digested and ligated into your desired plasmid. It is important to note that restriction...enzymes that cut your insert or backbone at only the desired location for your cloning project. Restriction ...rapidly shuttled into any compatible Gateway destination vector, which contains attR sites, via LR clonase...bacterial recombination to easily move it into any destination plasmid that fits your experimental goal. Although... Gateway donor , Gateway entry , and Gateway destination vectors with different promoters, tags, selection...Any dsDNA fragments can be used, so if properly designed, any insert fragment (PCR product or synthesized...sequences are removed from the final product, with no undesired sequence ("scar") retained. A disadvantage of ...
  15. Adenovirus Guide

    Type
    Guide
    ... Science Guides Viral Vectors Adenoviral Vector Guide Adenoviral...most widely used viral vector platform for vaccine design against a diversity of viruses. This guide contains...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...be harvested about 7–10 days later. Vogelstein designed multiple shuttle plasmids for different purposes...but has, however, proven to be very useful for designing and producing rAdV-based vaccines. Adenoviral ...altering gene activity. Oncolytic Referring to the destruction of cancer cells, generally by lysis. pAdEasy-...
  16. Promoters

    Type
    Guide
    ...Figure 1). The coding strand is the DNA strand that encodes codons and whose sequence corresponds to the mRNA...or inducible expression. Promoter Expression Description T7 Constitutive Promoter from T7 bacteriophage...different conditions. Promoter Expression Species Description Ac5 Constitutive Insect Strong promoter from ...
  17. Sequencing Primers

    Type
    Guide
    ...primers. You can also use Addgene’s protocol to design your own primers . Still have questions about choosing... Sequencing Primers Name Sequence (5' to 3') Description Direction BGH-R TAGAAGGCACAGTCGAGG Bovine growth... Sequencing Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia...
  18. Educational Resources

    Type
    Guide
    ...educational resources, including eBooks, science guides, videos, and protocols...Creating Bacterial Glycerol Stocks Restriction Digests Guides Browse our in-depth instructional content on subjects...
Showing: 1 - 18 of 18 results