Skip to main content
Addgene
Showing: 1 - 9 of 9 results
  1. Retrovirus Guide

    Type
    Guide
    ...genes (viral Gag-Pol): Gag is a structural precursor protein, and Pol is a polymerase. Envelope gene (...the same gene products for packaging (i.e., Gag, Pol, and Env), the isoforms of these proteins, as well... a packaging cell line that stably expresses Gag-Pol and/or Env, eliminating the need to deliver these...developed by Garry Nolan at Stanford contains Gag-Pol and either an ecotropic envelope, Phoenix-ECO, (for.... Another variant, Phoenix-gp, contains only Gag-Pol and enables additional flexibility in pseudotyping...lentiviruses and standard γ-retroviruses use the Gag, Pol, and Env genes for packaging; however, they are different...containing Matrix, Capsid, and Nucleocapsid components. Pol in trans Precursor protein containing Reverse Transcriptase...
  2. Lentiviral Guide

    Type
    Guide
    ...All on one plasmid: Gag, Pol, Rev, Tat Two plasmids: one encoding Gag and Pol and another encoding Rev... to drive RNA pol III-directed transcription of shRNAs. cDNA expression requires RNA pol II, and thus ...contains a single packaging plasmid encoding the Gag, Pol, Rev, and Tat genes. The transfer plasmid contains...plasmids: one encoding Rev and one encoding Gag and Pol. Although safer, this system can be more cumbersome...generation packaging systems: express the HIV gag, pol, rev, and tat genes all from a single packaging plasmid...3rd generation packaging systems: express gag and pol from one packaging plasmid and rev from another, ...lentiviruses and standard retroviruses use the gag, pol, and env genes for packaging; however, they are different...
  3. Promoters

    Type
    Guide
    ...because they control the binding of RNA polymerase to DNA. RNA polymerase transcribes DNA to mRNA which is ultimately... factors in order for RNA polymerase II (a eukaryote-specific RNA polymerase) to bind to a promoter. Transcription...the RNA polymerase binding site, TATA box, and transcription start site (TSS). RNA polymerase will bind...binding of the RNA polymerase. A transcription complex is constructed from the RNA polymerase and several transcription...T7 RNA polymerase Promoter from T7 bacteriophage Sp6 Constitutive but requires Sp6 RNA polymerase Promoter...and trp Types of RNA Polymerases Promoters control the binding of RNA polymerase to DNA to initiate the...three types of RNA polymerases that all transcribe different genes. RNA polymerase I transcribes genes...
  4. Cloning

    Type
    Guide
    ...and thymine (T). TOPO® cloning utilizes the Taq polymerase which naturally leaves a single adenosine (A)...Additionally, the efficiency can vary depending on the polymerase used, and the single A overhangs degrade over...common molecular biology enzymes: 5' exonuclease, polymerase and ligase. 5' exonuclease digests the 5' end...to generate 3' single-stranded overhangs. DNA polymerases synthesize DNA molecules using the 4 nucleotides...anneal to each other due to their homology. DNA polymerase then closes the gap created by the 5’ exonuclease...relies on the 3'-5' exonuclease activity of T4 DNA polymerase. An exonuclease is an enzyme which removes nucleotides... the end of a DNA strand. In LIC, the T4 DNA polymerase’s exonuclease activity creates “chewed-back” overhangs...
  5. Sequencing Primers

    Type
    Guide
    ...vector, forward primer Polyhedrin forward AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer...primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For baculovirus vector with polyhedrin promoter...Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region, reverse primer CAT-R GCAACTGACTGAAATGCCTC... Reverse GTGGTTTGTCCAAACTCATC (Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...forward primer SV40pA-R GAAATTTGTGATGCTATTGC SV40 polyA, reverse primer SV40pro-F TATTTATGCAGAGGCCGAGG SV40...primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial...
  6. Antibody Guide

    Type
    Guide
    ...lower background signals than polyclonal antibodies. However, polyclonal antibodies are more sensitive...clone that are specific to a certain epitope, or polyclonal, meaning there are many clones that are specific... antibodies are typically more expensive than polyclonal antibodies. Environmental factors, binding partners...available epitope on your protein of interest. Polyclonal antibodies are typically collected directly from...targeting various epitopes on the same antigen. Polyclonal antibodies are often more environmentally stable...protein in any form it may be present in. However, polyclonals can vary significantly from lot to lot, as immune...consider the following questions: Do you need polyclonal or monoclonal antibodies? Will you be using a...
  7. Optogenetics Guide

    Type
    Guide
    ...optogenetics tool - they typically allow the fast depolarization of neurons upon exposure to light through direct... trafficks well to the membrane. Excitatory (Depolarizing) ChR Variants. The optogenetic toolbox has been...light-gated, cation channels resulting in excitation (depolarization) of the neuron. Feature enhancements include..., Chrimson, ChrimsonR, Chronos Inhibitory (Hyperpolarizing) ChR Variants. Alternatively, ChR variants ...chloride channels, these variants result in the hyperpolarization of neurons. Examples of anion channel variants...NpHR (from Natronomonas pharaoni ), causes hyperpolarization (inhibition) of the cell when triggered with... a light-activated outward proton pump that hyperpolarizes (inhibits) the cell when triggered by green-yellow...
  8. Molecular Biology Reference

    Type
    Guide
    ...DNA polymerase adding nucleotides. The major difference in this process occurs when the polymerase incorporates.... During replication, DNA unwinds and the DNA polymerase enzyme binds to and migrates down the single ...replication requires the 4 nucleotides, a DNA polymerase enzyme, the template DNA to be copied, and a ... DNA and acts as a starting point for the DNA polymerase. Thus to replicate a piece of DNA in vitro one...
  9. CRISPR Guide

    Type
    Guide
    ...159 (3), 647–661. PMID: 25307932 Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford...
Showing: 1 - 9 of 9 results