Skip to main content

We narrowed to 12 results for: gnas

Showing: 1 - 12 of 12 results
  1. Antibody Guide

    Type
    Guide
    ...antibody and conjugate chosen. Signal Amplification The amount of signal needed from a specific antibody...abundant target, it obscures fainter signals. Fluorophores can emit signals that overlap with each other. Choose... Other Affinity Reagents Handling Visualization Signal Amplification Application Overview Quantification...Fc region. This allows for the amplification of signals by having multiple secondary antibodies binding...sdAbs is usually achieved by conjugation of a signaling molecule directly to the sdAb, or by using a secondary... incorporated in the sdAb. sdAbs can have weak signals due to their monovalent nature. Darpins - Darpins...single arm of the Y). They can be conjugated to signaling molecules and are often used in clinical applications...
  2. Chemogenetics Guide

    Type
    Guide
    ...classified by the signaling protein that the receptors couple to. Gq-DREADDs Gq-DREADDs signal through the ...Gi-DREADDs Gi-DREADDs signal through the Gαi/o G-protein and inhibit neuronal signaling by inhibiting adenylate...Gs-DREADDs Gs-DREADDs signal through the Gαs G-protein and activate neuronal signaling by increasing intracellular...small molecules that do not affect endogenous signaling, allowing precise control over a targeted cell...then activates G-proteins to modulate downstream signaling. GPCRs have been shown to be involved in a wide...of biological processes, including initiating signaling pathways in inflammation and neurotransmission...couples to β-arrestin to activate noncanonical GPCR signaling independent of G proteins. This DREADD, termed...
  3. Optogenetics Guide

    Type
    Guide
    ... eNpHR3.0 includes trafficking signal from Kir2.1 and ER export signal for improved membrane targeting...and an opsin engineered to activate a specific signaling pathway when exposed to light. Optical switches... the absorption spectrum or adding trafficking signals to localize opsins to the cell membrane. Microbial...Other Opsin-based Tools OptoXRs GPCRs activate signaling cascades driving a variety of physiological processes...activation of the major heterotrimeric G-protein signaling pathways in animal cells, but they can be difficult...control precisely due to the complexity of these signaling networks and other limitations like bleaching....receptor, makes a receptor that activates the native signaling cascade upon light exposure. OptoXRs and OptoGPCRs...
  4. Adenovirus Guide

    Type
    Guide
    ... deleted, except for the ITRs and the packaging signal, which is located adjacent to the left ITR, resulting...Flp-FRT recombination systems to excise the packaging signal from the HV genome or using other plasmids instead...vector platforms within the gene therapy landscape . Signal Transduction and Targeted Therapy, 6 (1), 53. https...recombination. Psi (Ψ) in cis Packaging or encapsidation signal located at the left arm of the genome adjacent ...viral genome packaging. In helper viruses, this signal is flanked by loxP sites so they can be excised...Non-specific immune response that responds to general signals of infection or damage. Insertional mutagenesis...
  5. CRISPR Guide

    Type
    Guide
    ...PAM) The PAM sequence (NGG) serves as a binding signal for Cas9, but the exact sequence depends on which...the aptamer improves stability and amplifies the signal for better imaging of genomic loci, as in the CRISPR-Sirius...degraded by Cas12a, it will release a quantifiable signal that indicates the presence of your target DNA ...cleaves the reporter as well, and a quantifiable signal is produced, indicating the presence of that specific...30377362 Casini, A., Olivieri, M., Petris, G., Montagna, C., Reginato, G., Maule, G., Lorenzin, F., Prandi...Pederson, T. (2018). CRISPR-Sirius: RNA scaffolds for signal amplification in genome imaging. Nature Methodss...Vale, R. D. (2014). A Protein-Tagging system for signal amplification in gene expression and fluorescence...
  6. Sequencing Primers

    Type
    Guide
    ...Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward pBAD Forward...Alpha-factor TACTATTGCCAGCATTGCTGC Alpha factor signal sequence Forward Amp-R ATAATACCGCGCCACATAGC 5' ...GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG 3...
  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... nuclear export. Poly(A) signal in cis The polyadenylation or poly(A) signal aids in the nuclear export...serve as origins of replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. ...used to detect, measure, and control molecular signals of cells (commonly neurons) in response to light...
  8. Science Guides

    Type
    Guide
    ...applications, which often use antibodies conjugated to a signaling molecule, can be used to capture, quantify, and...receptors to selectively control and investigate cell signaling pathways. Receptors are remotely controlled via...light to detect, measure, and control molecular signals and cells in order to understand their functions...
  9. Modular Cloning Guide

    Type
    Guide
    ...transcriptional unit (for example, a promoter, a 5' UTR, a signal peptide, a protein-coding gene, and a terminator...backbones, fluorescent proteins, protein tags, and signal peptides, for use in a range of organisms including...
  10. Promoters

    Type
    Guide
    ... Promoters Plasmids 101: Terminators and PolyA signals More Plasmids 101 topics Content last reviewed:...
  11. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...increased nuclear export. Psi (Ѱ) in cis RNA packaging signal; recognized by nucleocapsid proteins and essential...
  12. Lentiviral Vector Guide

    Type
    Guide
    ...Rev protein binds. Psi (Ѱ) in cis RNA packaging signal; recognized by nucleocapsid proteins and essential...
Showing: 1 - 12 of 12 results