|
|
136244 |
pMal-EcPhr |
EcPhr (Other)
|
Sancar |
Jan 16, 2020 |
|
|
136246 |
pcDNA4-Claspin-Flag |
Claspin (Homo sapiens)
|
Sancar |
Jan 16, 2020 |
|
|
136242 |
pcDNA4-ZfCry4 |
ZfCry4 (Danio rerio)
|
Sancar |
Jan 16, 2020 |
|
|
119282 |
ID1GFP Donor |
Id1GFP + homology arms (Mus musculus)
|
Massague |
Jan 16, 2020 |
|
|
119281 |
BRCA1-plvxt |
BRCA1 (Homo sapiens)
|
Massague |
Jan 16, 2020 |
|
|
119280 |
ID1-pLVXT |
Id1 (Mus musculus)
|
Massague |
Jan 16, 2020 |
|
|
99694 |
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2 |
dCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Mus musculus)
|
Church |
Jan 16, 2020 |
|
|
122880 |
pICE MET17 |
|
Hampton |
Jan 16, 2020 |
|
|
135252 |
p667-UBC-BRSK2-V5-miniTurbo_IDG-K |
BRSK2-V5-miniTurbo (Homo sapiens)
|
Major |
Jan 15, 2020 |
|
|
135250 |
p667-UBC-TLK2-V5-TurboID_IDG-K |
TLK2-V5-TurboID (Homo sapiens)
|
Major |
Jan 15, 2020 |
|
|
135273 |
p663-UBC-V5-BRSK2_IDG-K |
V5-BRSK2 (Homo sapiens)
|
Major |
Jan 15, 2020 |
|
|
135239 |
p667-UBC-hcRed-V5_IDG-K |
hcRed-V5 (Other)
|
Major |
Jan 15, 2020 |
|
|
135272 |
p663-UBC-TurboID-V5-BRSK2_IDG-K |
TurboID-V5-BRSK2 (Homo sapiens)
|
Major |
Jan 15, 2020 |
|
|
135269 |
p663-UBC-miniTurbo-V5-BRSK1_IDG-K |
miniTurbo-V5-BRSK1 (Homo sapiens)
|
Major |
Jan 15, 2020 |
|
|
135271 |
p663-UBC-miniTurbo-V5-BRSK2_IDG-K |
miniTurbo-V5-BRSK2 (Homo sapiens)
|
Major |
Jan 15, 2020 |
|
|
136972 |
pGGD_RT_li_Tq2CFP_2NLS |
Tq2CFP (Synthetic)
|
Theres |
Jan 15, 2020 |
|
|
136973 |
pGGD_RT_li_Venus |
Venus (Synthetic)
|
Theres |
Jan 15, 2020 |
|
|
136971 |
pGGD_RT_li_Tq2CFP |
Tq2CFP (Synthetic)
|
Theres |
Jan 15, 2020 |
|
|
133992 |
pHP038Env |
Envelope Glycoprotein
|
Garg |
Jan 15, 2020 |
|
|
136967 |
pGGC_RT_mScarlet |
mScarlet (Synthetic)
|
Theres |
Jan 15, 2020 |
|
|
136966 |
pGGB_RT_Venus_li |
Venus (Synthetic)
|
Theres |
Jan 15, 2020 |
|
|
136965 |
pGGB_RT_Tq2CFP_li |
Tq2CFP (Synthetic)
|
Theres |
Jan 15, 2020 |
|
|
136964 |
pGGB_RT_tdTomato_li |
tandem Tomato (Synthetic)
|
Theres |
Jan 15, 2020 |
|
|
136981 |
pGGF_RT_FAST_Tq2CFP |
seed coat marker, replaced RFP w/ Tq2CFP. Replaced NOS terminator w/ Arabidopsis HSP18-2 terminator (Synthetic)
|
Theres |
Jan 15, 2020 |
|
|
136978 |
pGGE_RT_Sa_sgRNA |
Sa guide RNA (Synthetic)
|
Theres |
Jan 15, 2020 |
|
|
135258 |
p667-UBC-BRSK1-V5-miniTurbo_IDG-K |
BRSK1-V5-miniTurbo (Homo sapiens)
|
Major |
Jan 15, 2020 |
|
|
135259 |
p667-UBC-BRSK1-V5_IDG-K |
BRSK1-V5 (Homo sapiens)
|
Major |
Jan 15, 2020 |
|
|
135253 |
p667-UBC-BRSK2-V5-TurboID_IDG-K |
BRSK2-V5-TurboID (Homo sapiens)
|
Major |
Jan 15, 2020 |
|
|
136979 |
pGGF_RT_FAST_RFP |
seed coat marker RFP (Synthetic)
|
Theres |
Jan 15, 2020 |
|
|
136977 |
pGGD_RT_2NLS |
SV40 NLS (Synthetic)
|
Theres |
Jan 15, 2020 |
|
|
136961 |
pGGA_RT_pLexA |
pLexA (Synthetic)
|
Theres |
Jan 15, 2020 |
|
|
136980 |
pGGF_RT_FAST_Venus |
seed coat marker, replaced RFP w/ Venus. Replaced NOS terminator w/ Arabidopsis HSP18-2 terminator (Synthetic)
|
Theres |
Jan 15, 2020 |
|
|
136968 |
pGGC_RT_Sa_sgRNA |
Sa guide RNA (Synthetic)
|
Theres |
Jan 15, 2020 |
|
|
135301 |
pQE-60NA-msGFP2 |
msGFP2
|
Glick |
Jan 15, 2020 |
|
|
136287 |
pAVB004 - GATA23pro |
GATA23pro (Arabidopsis thaliana)
|
Maizel |
Jan 15, 2020 |
|
|
133510 |
pAV0816 |
pAde6(PmeI)-p(act1)-CRIB(gic2aa2-181)-mTagBFP2-terminator(ScADH1)-bsdMX (Schizosaccharomyces pombe)
|
Martin |
Jan 15, 2020 |
|
|
136286 |
pLB052 - deAct - SpVB |
deAct - SpvB (Other)
|
Maizel |
Jan 15, 2020 |
|
|
132403 |
pHAGE-IRES-puro-NLS-dPspCas13b-2xmNeongreen-3xFlag |
dPspCas13b (Other)
|
Chen |
Jan 15, 2020 |
|
|
132408 |
pHAGE-IRES-puro-NLS-dLbaCas13a-EGFP-NLS-3xFlag |
dLbaCas13b (Other)
|
Chen |
Jan 15, 2020 |
|
|
135104 |
pcDNA5FRTTO-NHASt-codoptUL23 |
HSV-1 UL23 codon optimized (Synthetic)
|
Landthaler |
Jan 15, 2020 |
|
|
135099 |
pcDNA5FRTTO-codoptUL23-CStHA |
HSV-1 UL23 codon optimized (Synthetic)
|
Landthaler |
Jan 15, 2020 |
|
|
104911 |
BB3cN_pGAP_23*_pPFK300_Cas9 |
HH - FS23 linker - HDV (Other), human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS) (Homo sapiens)
|
Gasser |
Jan 14, 2020 |
|
|
132401 |
pHAGE-IRES-puro-NLS-dPspCas13b-mNeongreen-NLS-3xFlag |
dPspCas13b (Other)
|
Chen |
Jan 14, 2020 |
|
|
132409 |
pHAGE-IRES-puro-NLS-dRanCas13b-EGFP-NLS-3xFlag |
dRanCas13b (Other)
|
Chen |
Jan 14, 2020 |
|
|
1000000146 |
CyanoGate Kit |
|
McCormick |
Jan 14, 2020 |
|
|
132411 |
pHAGE-IRES-puro-NLS-dRfxCas13d-EGFP-NLS-3xFlag |
dRfxCas13b (Other)
|
Chen |
Jan 14, 2020 |
|
|
135183 |
TPC2-mCherry |
TPC2 (Mus musculus)
|
Galione |
Jan 14, 2020 |
|
|
135465 |
TDH3-STE2Δ(301-431)-BFP-CIBN-MKII-eLOV-TEVcs(ENLYFQ/M)LexAVP16-tCYC |
STE2Δ(301-431)-BFP-CIBN-MKII-eLOV-TEVcs(ENLYFQ/M)-LexAVP16 (Synthetic)
|
Ting |
Jan 14, 2020 |
|
|
135463 |
Syn:eGFP-CaM-uTEV1Δ(220-242) |
eGFP-CaM-uTEV1Δ (Synthetic)
|
Ting |
Jan 14, 2020 |
|
|
135462 |
Syn:NRX-TM-Nav1.6-CIBN-2xMKII-hLOV-TEcs(ENLYFQ/M)-tTA |
NRX-TM-Nav1.6-CIBN-2xMKII-hLOV-TEVcs(ENLYFQ/M)-tTA (Synthetic)
|
Ting |
Jan 14, 2020 |