We narrowed to 4,658 results for: crispr c plasmids
-
Plasmid#214045PurposeBacterial expression plasmid for SAVED-CHAT and PCaspase C-terminal fragment (aa 154-666) from Haliangium ochraceumDepositorInsertSAVED-CHAT-PCaspase
UseTagsExpressionBacterialMutationaa 154-666PromoterlacUV5 promoterAvailable sinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCbh-SpRY[C-term]-gRNAentry (CA20)
Plasmid#197511PurposeCbh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpRY and BsmBI entry cassette to clone SpCas9 gRNA spacerDepositorInsertAAV-[ITR]-pCbh-BPNLS-NpuC-SpRY[C-term]-BPNLS-gRNA[BsmBI]-pU6-[ITR]
UseAAV and CRISPRTagsBPNLS and BPNLS-NpuC(intein)ExpressionMutationC-terminal mutations of SpRY(L1111R/D1135L/S1136W…PromoterCbhAvailable sinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-C-intein-C-spC9-H840A-N863A-2xNLS-hGH
Plasmid#112211PurposeTargeted DNA methylationDepositorInsertC-terminus of dCas9
UseAAVTagsExpressionMutationD10APromoterAvailable sinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-mCherry-P2A-Cre-WPRE (AAV1)
Viral Prep#107312-AAV1PurposeReady-to-use AAV1 particles produced from AAV-hSyn-mCherry-P2A-Cre-WPRE (#107312). In addition to the viral particles, you will also receive purified AAV-hSyn-mCherry-P2A-Cre-WPRE plasmid DNA. hSyn-driven expression of mCherry and Cre (physically separate). These AAV preparations are suitable purity for injection into animals.DepositorPromoterTagsmCherry (physically separate, not a fusion protein)Available sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-PE2-C
Plasmid#164908PurposeExpresses the C-terminal split-intein fragment of PE2DepositorInsertPE2-C
UseAAVTagsExpressionMutationPromoterAvailable sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV8-cPE-C
Plasmid#183539PurposeDeliver a split compact Prime Editor in vivoDepositorInsertC-terminal fragment of SpCas9 nickase (H840A), Reverse Transcriptase
UseAAVTagsExpressionMammalianMutationPromoterU1AAvailable sinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCP-tRNA
Plasmid#133812PurposeCRISPR-Cas9 system for genetic manipulation of Candida parapsilosis, C. orthopsilosis, and C. metapsilosisDepositorInsertcassette for the expression of the sgRNA from the C. parapsilosis RNA pol II GAPDH promoter
UseCRISPRTagsExpressionMutationPromoterAvailable sinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
C-Terminal Split Cas9 with GyrA intein
Plasmid#58694PurposeExpresses truncated C-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with N-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized C-Terminal S. pyogenes Cas9 with GyrA Csplit Intein
UseAAV and CRISPRTagsGyrA Csplit Intein and NLSExpressionMammalianMutationPromoterCBhAvailable sinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
PE_CO-Mini-C
Plasmid#190337PurposeExpressing the C-terminal of PE_CO-Mini using Rma intein and Cas9 673-674 split site, and pegRNA for PCSK9 +1A insertionDepositorInsertPE_CO-Mini-C, PCSK9 +1A insertion pegRNA
UseAAVTagsExpressionMutationPromoterAvailable sinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-scaffold (2xBsmBI sites)
Plasmid#120294PurposeAAV Vector for expression of C-terminal SpyCas9 fragemnt with split-intein and a CMV-driven AcrIIA4 (no miR binding sites)DepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianMutationPromoterAvailable sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF589-donor
Plasmid#112340PurposeCRISPR donor plasmid to tag human transcription factor ZNF589 with GFPDepositorInsertZNF589 homology arms flanking EGFP-IRES-Neo cassette (ZNF589 Human)
UseCRISPRTagsExpressionMutationhg38:3:48267877:T>C, hg38:3:48267890:C>T, h…PromoterAvailable sinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZNF445-donor
Plasmid#112332PurposeCRISPR donor plasmid to tag human transcription factor ZNF445 with GFPDepositorInsertZNF445 homology arms flanking EGFP-IRES-Neo cassette (ZNF445 Human)
UseCRISPRTagsExpressionMutationrs78585428, hg38:3:44446218:C>T, hg38:3:444466…PromoterAvailable sinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJB07
Plasmid#190481PurposeTargeting plasmid for 2-plasmid C. difficile mutagenesis systemDepositorInsertsUpstream & Downstream pyrE deletion region
gRNA
UseE. coli / b. subtilis - c. difficile shuttle vect…TagsExpressionMutationPromoterAvailable sinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA-Lib
Plasmid#53121PurposesgRNA expression construction in a 3rd generation lentiviral backboneDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only