We narrowed to 4,662 results for: crispr c plasmids
-
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZNF445-donor
Plasmid#112332PurposeCRISPR donor plasmid to tag human transcription factor ZNF445 with GFPDepositorInsertZNF445 homology arms flanking EGFP-IRES-Neo cassette (ZNF445 Human)
UseCRISPRMutationrs78585428, hg38:3:44446218:C>T, hg38:3:444466…Available SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJB07
Plasmid#190481PurposeTargeting plasmid for 2-plasmid C. difficile mutagenesis systemDepositorInsertsUpstream & Downstream pyrE deletion region
gRNA
UseE. coli / b. subtilis - c. difficile shuttle vect…Available SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE_KKH C-terminal
Plasmid#137184PurposeAAV genome: expresses the C-terminal of S. aureus v5 AAV-CBE, and U6-sgRNA (KKH variant).DepositorInsertv5 AAV-saCBE_KKH C-terminal
UseAAVMutationE782K;N968K;R1015H conferring recognition of NNNR…PromoterCbhAvailable SinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-haA3A-CBE-G-C
Plasmid#220899PurposeAAV genome encoding the C-terminal of haA3A-CBE-G, and sgRNADepositorInserthaA3A-CBE-G-C
UseAAVExpressionMammalianAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE C-terminal
Plasmid#137183PurposeAAV genome: expresses the C-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-saCBE C-terminal
UseAAVPromoterCbhAvailable SinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSAVED-CHAT_PCaspase-N-C-term
Plasmid#214046PurposeBacterial expression plasmid for SAVED-CHAT, PCaspase N-terminal fragment (aa 1-153), and C-terminal fragment (154-666) from Haliangium ochraceumDepositorInsertSAVED-CHAT-PCaspase
ExpressionBacterialMutationaa 1-153, 154-666PromoterlacUV5 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSQT1313
Plasmid#53370Purposemultiplex gRNA expression plasmidDepositorInsertNone
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-2xmiR-122 target sites
Plasmid#120295PurposeAAV Vector for expression of C-terminal SpyCas9 fragement with split-intein and a CMV-driven AcrIIA4 with two miR-122 binding sitesDepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVEZF1-donor
Plasmid#112341PurposeCRISPR donor plasmid to tag human transcription factor VEZF1 with GFPDepositorInsertVEZF1 homology arms flanking EGFP-IRES-Neo cassette (VEZF1 Human)
UseCRISPRMutationrs999907002, hg38:17:57975308:A>T, hg38:17:579…Available SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCP-tRNA
Plasmid#133812PurposeCRISPR-Cas9 system for genetic manipulation of Candida parapsilosis, C. orthopsilosis, and C. metapsilosisDepositorInsertcassette for the expression of the sgRNA from the C. parapsilosis RNA pol II GAPDH promoter
UseCRISPRAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
AIO-GFP
Plasmid#74119PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and EGFP-coupled Cas9-D10A nickase to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
AIO-mCherry
Plasmid#74120PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and mCherry-coupled Cas9-D10A nickase to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-2-RPB1-C-term
Plasmid#195109PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 C-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against last exon of RPB1 (C-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZNF250-donor
Plasmid#112383PurposeCRISPR donor plasmid to tag human transcription factor ZNF250 with GFPDepositorInsertZNF250 homology arms flanking EGFP-IRES-Neo cassette (ZNF250 Human)
UseCRISPRMutationhg38:8:144882271:C>G,hg38:8:144882273:T>CAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJB06
Plasmid#190480PurposeBase Cas9 expression plasmid for 2-plasmid C. difficile mutagenesis systemDepositorInsertsCas9
XylR
UseE. coli / b. subtilis - c. difficile shuttle vect…PromoterxylR-driven promoterAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only