We narrowed to 3,333 results for: pEGFP
-
Plasmid#69837PurposeThis plasmid encodes PLK4 isoform 1 with an N-terminal EGFP tag and C-terminal 3xFLAG tagDepositorAvailable sinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (WT)
Plasmid#196702PurposePlasmid for transient mammalian expression of wild type RNase H1 tagged with 2xNLS and EGFP that can be used to specifically degrade the nuclear R-loops.DepositorInserthuman RNaseH1 wild type
ExpressionMammalianAvailable sinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pegfp-N1-TFEB-S3A,R4A
Plasmid#44446DepositorInsertTFEB (TFEB Human)
TagsGFPExpressionMammalianMutationChanged both Serine 3 and Arginine 4 to AlaninePromoterCMVAvailable sinceApril 26, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFPC1-human APPL1
Plasmid#22198DepositorPublicationInsertAdaptor protein containing PH domain, PTB domain and Leucine zipper motif (APPL1 Human)
TagsGFPExpressionBacterial and MammalianAvailable sinceOct. 21, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-MRLC1 T18D, S19D
Plasmid#35682DepositorPublicationAvailable sinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP PICH (Nigg CB62)
Plasmid#41163DepositorPublicationAvailable sinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFPC1-EPSIN 1
Plasmid#22228DepositorPublicationInsertEpsin 1 (Epn1 Rat)
TagsGFPExpressionBacterial and MammalianMutationplease see depositor comment belowAvailable sinceOct. 9, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-MRLC T18A,S19A
Plasmid#35681DepositorPublicationAvailable sinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP Cep164 (Nigg CW324)
Plasmid#41149DepositorAvailable sinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-gfap(Intron1/5'/Exon1-zebrafish)
Plasmid#39761DepositorAvailable sinceAug. 21, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (D210N)
Plasmid#196703PurposePlasmid for transient mammalian expression of catalytically inactive RNase H1 mutant.DepositorInserthuman RNaseH1 D210N
ExpressionMammalianMutationD210N, catalytically inactiveAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP.N1-HDAC6.DC (catalytic deficient)
Plasmid#36189DepositorAvailable sinceApril 19, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFPC1-6XHis-FLKSRP
Plasmid#23001DepositorAvailable sinceNov. 29, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
peGFP(N1)-deltaCMV-rSyntaxin1a-meGFP
Plasmid#34631DepositorAvailable sinceFeb. 8, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GFP-Drosha
Plasmid#62520Purposewild-type human Drosha cDNA is subcloned into pEGFP-C1 vector between HindIII and KpnI sitesDepositorAvailable sinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFPC1-muscle Amphiphysin 2
Plasmid#22213DepositorAvailable sinceOct. 9, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP Rootletin (Nigg pFL2(CW499))
Plasmid#41166DepositorAvailable sinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-C3-Sec15
Plasmid#53760PurposepEGFP-C3 plasmid that expresses Sec15DepositorAvailable sinceAug. 1, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-C3-Sec8
Plasmid#53758PurposepEGFP-C3 plasmid that expresses Sec8DepositorAvailable sinceAug. 1, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by