We narrowed to 27,413 results for: Cat
-
Plasmid#239096PurposeExpresses truncated NRL, driven by EF1α promoter.DepositorArticleInsertNeural Retina Leucine Zipper (truncated) (NRL Human)
ExpressionMammalianAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCHC030 (∆CBBp ∆MBH ∆SH)
Plasmid#226205PurposeElectroporation knockout plasmid (pK18sB) to delete the CBBp, membrane-bound hydrogenase, soluble hydrogenase, and intervening sequences (∆CBBp ∆MBH ∆SH).DepositorInsertHomology arms for CBBp, MBH, and SH operons, and intervening sequencessequences.
UseSynthetic BiologyMutation∆cbbR ∆cbbLSXYEFPTZGKA ∆hoxKGZMLOQRTV ∆hypA1B1F1C…Available SinceNov. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
GFP Cav2.2 D122A pcDNA3
Plasmid#206068Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a D122A mutation that disrupts the interaction with ?2?-1DepositorAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_nmPKA-CαN-mPAGFP
Plasmid#114130PurposeMammalian expression of the G2A mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.DepositorInsertthe N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric paGFP, with G2A mutation (Prkaca Mouse)
ExpressionMammalianAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN067
Plasmid#91602PurposeExpress sgRNA targeting human DPP4DepositorAvailable SinceOct. 12, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPN170
Plasmid#91599PurposeExpress sgRNA targeting human DLGAP1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CHRFAM7ADelta2bp-YFP
Plasmid#62637Purposemammalian expression of human duplicated Alpha7-2 bp deletion (CHRFAM7A-∆2bp) with YFP fused into M3-M4 loopDepositorInsertCHRFAM7A (CHRFAM7A Human)
ExpressionMammalianMutationthere is a 2-bp deletion in exon 6 of CHRFAM7A an…PromoterCMVAvailable SinceMarch 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
Antibody#219629-rAbPurposeAnti-Neuroligin-3 (mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes mouse and human NLGN3. Does not cross-react with other NLGNs.DepositorArticleRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceNov. 11, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pGL403
Plasmid#119953PurposeExpresses GPPS and LimS, for the production of GPP and (S)-limonene, in Escherichia coli.DepositorInsertsgpps
limS
ExpressionBacterialMutationN-terminal truncation of 56 amino acid residues (…Available SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Dnmt3a3lCD
Plasmid#235576PurposeDox-inducible expression of the catalytic-domain (CD) of epigenetic effector Dnmt3a3L fused with scFV to programme DNA methylationDepositorAvailable SinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAST-pHuji-GINKO2
Plasmid#177117PurposeGenetically encoded green fluorescent potassium ion indicator GINKO2 and red fluorescent pH indicator pHuji fusionDepositorInsertpHuji-GINKO2
ExpressionInsectPromoterhsp70 promoterAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-N-3XFLAG-Ctnnb1
Plasmid#123586DepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-CTNNB1-HA
Plasmid#242217PurposeExpression of full-length human β-catenin using piggyBac transpositionDepositorAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKE12-ISceI-fabp10a:loxP-BFP-loxP-Xla.Ctnnb1
Plasmid#198240PurposeFor I-SceI-mediated transgenesis in zebrafish; fabp10a promoter drives expression of activated β-catenin preceded by a blue fluorescent protein (BFP)-STOP cassette flanked by loxP sitesDepositorInsertsUseZebrafish transgenesisAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPN441
Plasmid#137873PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRi; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A mKate2-hu_ncOGT K842M
Plasmid#154284PurposeEntry vector encoding mKate2-2xFLAG-OGT (O-GlcNAc Transferase; K842M variant, catalytic dead)DepositorInsertO-GlcNAc Transferase (OGT Human)
UseGateway entry vectorTags2x FLAG and mKate2MutationK842M mutation (Catalytic Inactive)Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC7A2
Plasmid#131937PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC7A2 (SLC7A2 Human)
ExpressionMammalianAvailable SinceOct. 17, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
p2XStrep-ATIC
Plasmid#125685Purposeexpresses human ATIC protein with an N-terminal 2XStrep affinity tagDepositorAvailable SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL
Plasmid#119952PurposeExpresses GPPS and LimS, for the production of GPP and (S)-limonene, in Escherichia coli.DepositorInsertsgpps
limS
ExpressionBacterialMutationN-terminal truncation of 56 amino acid residues (…Available SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only