We narrowed to 15,308 results for: EGF;
-
Plasmid#195967PurposeGateway p3E 2A fluorophoreDepositorInsert2A-EGFP
UseOtherAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-52: HIST1H2BJ-mEGFP
Plasmid#109121PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human HIST1H2BJDepositorInsertHIST1H2BJ Homology Arms with linker-mEGFP (H2BC11 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMay 4, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
459 p3E-2A-nlsEGFPpA
Plasmid#195969PurposeGateway p3E 2A fluorophoreDepositorInsert2A-nlsEGFP (nuclear)
UseOtherAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVSVΔG-eGFP-linker
Plasmid#231707PurposeEncodes the genome of VSV driven by a T7 polymerase promoter. It lacks the G protein (glycoprotein) and encodes eGFP.DepositorInsertVSV antigenome
UseVsv expressionExpressionMammalianMutationΔG (VSV glycoprotein removed)PromoterT7Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1/Halo-CAAX
Plasmid#249173PurposeMammalian expression vector of CAAX motif (plasma membrane marker) fused with Halo-tagDepositorInsertCAAX (HRAS Human)
TagsHaloExpressionMammalianMutationOnly 10 amino acids ending with CVLS (CAAX motif)PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.eGFP.2A.P301L-Tau
Plasmid#140425PurposeAAV.CBA.eGFP.2A.P301L-Tau propagation reporter P301L-2N4R-hTauDepositorInserteGFP-2A-Tau(P301L) (MAPT Synthetic, Human)
UseAAVTagseGFPMutationchanged Proline 301 to LeucinePromoterCBAAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
TK4-NLS-EGFP
Plasmid#239046PurposePiggyBac plasmid for stable transgene expression during human pluripotent stem cell differentiationDepositorInsertsEGFP
puroR-T2A-mycNLS-mTagBFP2
TagsT2A-mycNLS-mTagBFP2 and c-myc-NLSExpressionMammalianPromoterCAG and EF1aAvailable SinceMay 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS-SV40-mP-EGFP
Plasmid#137724PurposeLentivirus based EGFP expression vectorDepositorInsertSV40 enhancer
UseLentiviralExpressionMammalianAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVSV eGFP RABV-G
Plasmid#31833DepositorInsertVSV genome
ExpressionBacterialAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET24a-LaM4-EGFP
Plasmid#182641PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to EGFP. LaM4-EGFP also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-mCherry nanobody fused to a T7, HA, BAP and His6 epitope
TagsBAP, EGFP, HA, His6, and T7ExpressionBacterialPromoterT7Available SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-EGFP
Plasmid#50465PurposeEGFP under the control of human synapsin promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV Retrograde trial size, AAV1, AAV1 trial size, AAV11, AAV11 trial size, AAV2, AAV2 trial size, AAV5, AAV5 trial size, AAV8, AAV8 trial size, AAV9, and AAV9 trial sizeInsertEGFP
UseAAVTagsN/APromoterhuman Synapsin 1Available SinceMarch 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-parkin C431S
Plasmid#45877DepositorInsertParkin (PRKN Human)
TagsEGFPExpressionMammalianMutationC431S mutation (ubiquitin acceptor site)PromoterCMVAvailable SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EGFP-2xFYVE
Plasmid#136996PurposeLentiviral EGFP lipid sensor for PI(3)PDepositorInsertEGFP-2xFYVE
UseLentiviralTagsEGFPPromoterEF1 alphaAvailable SinceFeb. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVdual-CMV-eGFP
Plasmid#230931PurposepAAVdual plasmid is used to package AAV-CMV-eGFP viruses with the AAVdual system, which integrates the mini-pHelper-1.0 (providing E2A, E4orf6, and VA RNA) with an AAV expression cassette containing eGFP driven by the CMV promoter.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVtri-CMV-eGFP
Plasmid#230932PurposeUsed for producing AAV-CMV-eGFP viruses with the AAVtri triple-plasmid system. This system combines the use of the mini-pHelper-1.0 and AAV helper plasmids carrying different AAV serotypes.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Akna-mEGFP
Plasmid#196866PurposeExpression of the centrosomal protein Akna fused to enhanced (E)-GFPDepositorInsertAkna-mEGFP (Akna Mouse)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFX-mito-EGFP
Plasmid#159096PurposeExpress EGFP with mitochondria-targeting sequence in mammalian cellsDepositorInsertmCherry with mitochondria-targeting sequence
Tagsthe mitochondria-targeting sequence of the cytoch…ExpressionMammalianPromoterCMVAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMTTH+mEGFP-H1.4
Plasmid#157799PurposeExpression of mEGFP and human linker histone H1.4 fusion proteinDepositorAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMET7-GAG-EGFP
Plasmid#80605PurposeMammalian expression vector that expresses HIV-1 GAG with EGFP fused to itDepositorInsertEGFP
ExpressionMammalianPromoterSRalphaAvailable SinceAug. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-EGFP-tDeg
Plasmid#185400PurposeEGFP-tDeg fluorogenic proteinDepositorInsertEGFP-tDeg
ExpressionMammalianMutationWTPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only