We narrowed to 15,787 results for: ENA
-
Plasmid#103503PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-378a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-378a-3p target (MIR377 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1P-iCAG.copGFP
Plasmid#66577PurposeAAVS1 safe harbor gene targeting donor expressing CAG-driven copGFP, compatible with pZT-AAVS1 TALENsDepositorInsertcopGFP
ExpressionMammalianPromoterCAGAvailable SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV[Tet]-Puro-TRE3G>mMyod1[NM_010866.2]
Plasmid#184380PurposeThe mouse Myod1 gene is expressed under a doxcycline-inducible TRE3G promoterDepositorInsertMyod1 (Myod1 Mouse)
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-TaqStoffel (JO595)
Plasmid#208952PurposeA variant CE1 construct with Taq Stoffel DNA polymerase, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-TaqStoffel-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXs-IRES-blast GFP-SPNS1
Plasmid#198571PurposeSPNS1 codon-optimized orf with n-terminal 3xFlag GFP in pMXs-IRES-Blast vectorDepositorInsertSPNS1 with n-terminal 3xFlag-GFP fusion (SPNS1 Human)
UseRetroviralTags3xFlag-GFPExpressionMammalianAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfABC1D-NLS-GFP-WPRE-synpA-L1-R2
Plasmid#203541PurposegRNA expression in astrocytesDepositorInsertNLS-GFP, 2x U6-RNA
UseAAVExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-hygro-STING HAQ
Plasmid#102600PurposeExpress STING HAQ for IFN-beta Luciferase reporter assay.DepositorAvailable SinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-mCherry-PA-Rac1-C450A
Plasmid#22028PurposeExpression of Rac1 fused with light-insensitive LOV2 (C450A mutation)DepositorInsertPA-Rac1-C450A (RAC1 Avena sativa (oat), Human)
Tags6xHis and mCherryExpressionBacterial, Insect, and Mamm…MutationLOV(Leu404-Leu546, C450A). Rac1 starts at Ile4 an…PromoterCMV, p10Available SinceSept. 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-Lyso-FLAG-GFP-Sac1-Cat-WT
Plasmid#134645Purposelysosome-targeted Sac1 catalytic domain wild typeDepositorInsertSac1 catalytic domain (77-520 aa) (SACM1L Human)
UseLentiviralTagsFLAG, GFP, and lysosomal-tag (p18 N-terminal 1-39…ExpressionMammalianMutationcontains only amino acids 77-520 (Please see depo…Available SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only