We narrowed to 8,671 results for: aav
-
Plasmid#202613PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P in AAV production vector for neuron-specific expression using the promoter hSynDepositorInsertJEDI-1P
UseAAVExpressionMammalianPromoterhSynAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC840 - pAAV 5xATF6 secNLuc
Plasmid#82497PurposeLongitudinal monitoring of Gaussia and Nano luciferase activities to simultaneously assess ER calcium homeostasis and ER stress in vivoDepositorInsertsecNLuc
UseAAVExpressionMammalianPromoter5x(ATF6 binding site) c-Fos minimal promoterAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
AAVS1 EGFP-p62 HRD
Plasmid#207550PurposeHomologous recombination donor to integrate and expression cassette for eGFP-p62 in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-P62
TagsEGFPExpressionMammalianPromoterEndogenousAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 EGFP-LC3B HRD
Plasmid#207551PurposeHomologous recombination donor to integrate and expression cassette for eGFP-LC3B in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-LC3B
TagsEGFPExpressionMammalianPromoterEndogenousAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 EGFP-GABARAPL1 HRD
Plasmid#207552PurposeHomologous recombination donor to integrate and expression cassette for EGFP-GABRAPL1 in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-GABARAPL1
TagsEGFPExpressionMammalianPromoterEndogenousAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-MCP-huADARE488QT490A
Plasmid#159922PurposeFusion of MS2 coat protein to Human ADAR2 E488QT490A, under Ef1a promoter, with WPRE. AKA 116v5DepositorAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-SomaGCaMP7
Plasmid#182942PurposeCre-dependent expression of cell body-targeted GCaMP7f, under CAG promoter. As bright as conventional GCaMP7f.DepositorInsertSoma-GCaMP7
UseAAVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSOX9-dTAG-mNeonGreen-V5
Plasmid#194971PurposeAAV vector for knocking in a C-terminal tag (dTAG-mNeonGreen-V5) for human SOX9DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ASAP4b-Kv-WPRE
Plasmid#201030PurposeExpresses somatically enriched ASAP4b in neurons, can be used to package AAVDepositorInsertASAP4b-Kv
UseAAVAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLInChR-mVenus
Plasmid#119298PurposeFLinChR is the fusion signal sequence and transmembrane (TM) domain of Neurexin 1B-delta to ChR2E123T/T159C for inversion ChR2 to an optogenetic inhibitorDepositorInsertNx1BTM-FCS-ChR2ET/TC-mVenus
UseAAVTagsmVenusPromoterCAGAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pEF1a-EBFP-tTAn
Plasmid#172122PurposeConstitutive expression of EBFP and rtTA-InteinNDepositorInsertEBFP, tTAn-InteinN
UseAAVPromoterEF1aAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-mRuby3-WPRE
Plasmid#107744PurposeCan be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.DepositorInsertmRuby3
UseAAVExpressionMammalianPromoterCAGAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-C1V1 (t/t)-TS-mCherry
Plasmid#35500PurposeAAV expression of CaMKII-driven chimeric opsin variant C1V1 (E122T/E162T) for fast and potent optical excitation at red-shifted wavelengths.DepositorInsertChR1-VChR1 Chimera
UseAAVTagsmCherryExpressionMammalianMutationE122T and E162TPromoterCaMKIIaAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD2-ChR2-mCherry
Plasmid#170845PurposeAAV vector for Cre-dependent transgene expression of ChR2-mCherry in cortical interneurons under the control of the Dlx enhancer.DepositorInsertChR2-mCherry
UseAAVExpressionMammalianPromoterDlxAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGrin2b
Plasmid#124864PurposeMutagenesis of Grin2bDepositorInsertGrin2b (Grin2b Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-synaptoPAC-minWPRE
Plasmid#153085PurposeExpresses synaptoPAC, a fusion of synaptophysin, mScarlet, and bPAC in neuronsDepositorInsertsUseAAVTagsHis tag, mScarlet, and myc tagExpressionMammalianAvailable SinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-2P-Kv-WPRE
Plasmid#179463PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for neuron -specific expression using the promoter hSynDepositorHas ServiceAAV9InsertJEDI-2P-Kv
UseAAVExpressionMammalianPromoterhSynAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-p3-PE(1153-dRnH)-C-term
Plasmid#187182Purposep3-PE2-C-term(1153-dRnH) in AAV2 backbone (ITRs) targeting DNMT1DepositorInsertPE2 from plasmid #132775 with shortened RnaseH domain
UseAAVAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only