We narrowed to 12,047 results for: shRNA
-
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-ACTB-C4
Plasmid#229846PurposeExpresses wild-type Cas9 and gRNA for ACTB gene.DepositorInsertguide RNA for ACTB gene
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-NT2
Plasmid#229848PurposeExpresses wild-type Cas9 and gRNA with non-target sequence.DepositorInsertguide RNA with non-target sequence
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NQO1
Plasmid#214684PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human NQO1DepositorInsertdgRNA_NQO1 (NQO1 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
1167A
Plasmid#218233PurposeHDR plasmid for inserting Ceratitis capitata transformer female intron into the white pupae geneDepositorInsertputative metabolite transport protein
ExpressionInsectAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-dUG-D01
Plasmid#138962PurposeUsed in the editing of Drosophila kkvDepositorArticleInsertD01 oligo
UseCRISPR; To synthesize grnaAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmiRNA1-OE-METTL16 F187G-sgMETTL16-MUT1
Plasmid#196201Purposeoverexpress METTL16DepositorAvailable SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAM/CBA-eGFP-miRNegativex3-WPRE-bGHpA
Plasmid#194249PurposeExpresses 3 non-targeting miRNAsDepositorInsertmiRNegative
UseAAV and RNAiPromoterCAGAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-KIF11
Plasmid#188685Purposecontrol sgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-CDK1
Plasmid#188684Purposecontrol sgRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
cTRE-LSL-GFP-IRES-Cas9-sgPtenX1.1
Plasmid#135669PurposeIntroduce Dox/Cre-inducible (TRE promoter followed by lox-stop-lox) Cas9 cDNA plus Pten-targeting sgRNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertsgPten
UseMouse TargetingAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CUP1-1
Plasmid#166086PurposePlasmid for constituive spCas9 and tet-inducible CUP1-1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_TDH3
Plasmid#166084PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of TDH3 for double stranded break formation in yeast.DepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgNtn1
Plasmid#159907PurposeMutagenesis of Netrin1DepositorInsertNetrin1 (Ntn1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pE4F1.1.0-gDNA
Plasmid#132451PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertE4F1 (E4F1 Human)
UseCRISPRAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX335 Mouse 5' Srcap gRNA B
Plasmid#127905PurposeCas9 D10A Nickase Vector targeting the 5' end of the mouse Srcap geneDepositorInsertSrcap gRNA
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only