We narrowed to 8,879 results for: AMPH
-
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
POC1552
Plasmid#226499PurposepMOBC360_StandVC: Standard Vector (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protectionDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVP076
Plasmid#222028PurposeEmpty spectinomycin resistant GreenGate destination vector based on pGGP-AG. Domesticated of Esp3I sites in the backbone and chloramphenicol resistance gene.DepositorTypeEmpty backboneUseSynthetic Biology; Greengate compatible cloning v…MutationAll Esp3i sites domesticatedAvailable SinceDec. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSKA322
Plasmid#101676Purposeempty backbone with chloramphenicol resistanceDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJet1.2 cat cassette
Plasmid#117119PurposeChloramphenicol resistance cassetteDepositorInsertChloramphenicol resistance cassette for Bacillus subtilis selection
UseGolden gate donor vector for gene targeting in ba…Available SinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSAM_Cam
Plasmid#91570PurposeMariner transposon mutagenesis & sequencing vector - Transposon contains KanR and Illumina sequencing adapters. Lac promoter expresses transposase. Chloramphenicol resistance on backbone.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSWAP_Entry_H2_beta_CM
Plasmid#184870PurposepSwap plasmid part with H2_beta homology arms and chloramphenicol cassetteDepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceMarch 2, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKM402
Plasmid#107770PurposeExpression of phage Che9c RecT for oligo-mediated recombineering in mycobacteriaDepositorInsertsChe9C RecT
TetR (tet repressor)
cat
kan
ExpressionBacterialPromoterCat promoter, Ptet, kan promoter, and pTB21Available SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXLC_pFa
Plasmid#114219PurposePOC12355, MetClo assembly vector with p15A replication origin and chloramphenicol resistance for BsaI-based MetClo, adaptor sequence type p-aDepositorInsertLacZalpha
UseSynthetic BiologyAvailable SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
MBP-GFP-RGG
Plasmid#242453PurposeExpresses the MBP-GFP-RGG fusion protein.DepositorInsertMBP-GFP-RGG
TagsHis and MBPExpressionBacterialPromoterT7Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
GST-GFP-RGG
Plasmid#242454PurposeExpresses the GST-GFP-RGG fusion protein.DepositorInsertGST-GFP-RGG
TagsGST and HisExpressionBacterialPromoterT7Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1553
Plasmid#238470PurposepMOBC360_VL: Vector Left (VL) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1554
Plasmid#238471PurposepMOBC360_VR: Vector Right (VR) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1525
Plasmid#226496PurposepMOBC360_VM: Vector Middle (VM) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUdOm3.1
Plasmid#210283PurposeEmpty backbone with chloramphenicol resistance for high expression in mammalian cellsDepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUdOm4.1
Plasmid#210284PurposeEmpty backbone with chloramphenicol resistance for high expression in mammalian cellsDepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXBC_pFa
Plasmid#114249PurposePOC12391, MetClo assembly vector with F replication origin and chloramphenicol resistance for BsaI-based MetClo, adaptor sequence type p-aDepositorInsertLacZalpha
UseSynthetic BiologyAvailable SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only