We narrowed to 4,082 results for: Gaa
-
Plasmid#222907PurposeCas9/sgRNA plasmid for targeting FIGLADepositorInsertCas9, FIGLA sgRNA 2 (FIGLA Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_FIGLA_cterm1
Plasmid#222906PurposeCas9/sgRNA plasmid for targeting FIGLADepositorInsertCas9, FIGLA sgRNA 1 (FIGLA Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
lentiCRISPR v2-sgCYFIP1-1
Plasmid#210137Purposeknock out CYFIP1 in mammalian cellsDepositorInsertCytoplasmic FMR1-interacting protein 1 (CYFIP1 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgGPAA1 guide 1
Plasmid#193608PurposeGPAA1 knockoutDepositorInsertsgGPAA1 guide 1 (GPAA1 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgSNRPA guide 1
Plasmid#193598PurposeSNRPA knockoutDepositorInsertsgSNRPA guide 1 (SNRPA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shTgm5-1
Plasmid#180394PurposeProducing AAV that encodes mouse Tgm5 shRNA-1 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-1
Plasmid#124474PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-1_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRbm10#2/Cre
Plasmid#173651PurposeExpresses a Rbm10-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Rbm10 (Rbm10 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon5
Plasmid#177763PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon8
Plasmid#177764PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZNF169.2.0-gDNA
Plasmid#112472PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF169DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN095
Plasmid#91622PurposeExpress sgRNA targeting human GRIN2ADepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
CTp130-Reporter-NT
Plasmid#256440PurposeMammalian expression of a TSM with half of GFP-2A-BFP with non-targeting spacerDepositorInsertTrans-splicing module with half of GFP-2A-BFP with non-targeting spacer
ExpressionMammalianPromoterSFFVAvailable SinceMay 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
RhoC gRNA #1
Plasmid#198724PurposeCas9-mediated knockout of RhoC in mammalian cells #1DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-shBIRC6-2(3)-C911
Plasmid#202452Purposea seed-matched control for pRSITEP-puro-shBIRC6-2(3)DepositorAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e1 and e4
Plasmid#190688PurposesgRNAs targeting enhancer 1 and 4 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 1 and 4 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZFP1.1.0-gDNA
Plasmid#112470PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZFP1DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -