We narrowed to 16,879 results for: Cas9
-
Plasmid#167890PurposePiggyBac compatible plasmid expressing Cas9-VPRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9-VPR
UseCRISPRAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_VPR_EBFP2
Plasmid#167889PurposePiggyBac compatible plasmid expressing Cas9-VPRDepositorInsertCas9-VPR
UseCRISPRAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A_D10A-1x6
Plasmid#58776PurposeExpresses Cas9 nickase and gRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthumanized S. pyogenes Cas9 (D10A) nickase
UseCRISPRTags3xFLAGExpressionMammalianMutationD10A nickase-converting mutationPromoterCBhAvailable sinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
phumanCas9 (GB0575)
Plasmid#68206PurposeProvides the human codon optimized CDS of Cas9 protein as a level 0 GoldenBraid partDepositorInsertCas9 coding region (human codon optimised)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removed; human codon optimis…Available sinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAct:dCas9-VPR
Plasmid#78898PurposeExpresses dCas9-VPR under Actin promoter for CRISPRa in Drosophila cell culture. Please note- this plasmid does not express GFP.DepositorInsertdCas9-VPR
UseCRISPRExpressionInsectPromoterpActin (Drosophila)Available sinceAug. 12, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
YE1-BE4max
Plasmid#138155PurposeC-to-T base editorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertrAPOBEC1(YE1)-nSpCas9-UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 W90Y + R126E; within Cas9 D10APromoterCMVAvailable sinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC57-Simple-gRNA backbone
Plasmid#51306PurposegRNA expression plasmidDepositorPublicationTypeEmpty backboneUseCRISPR; Xenopus expressionPromoterT7Available sinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MTK0_047
Plasmid#123977PurposeEncodes the Cas9 hCLYBL homology destination with Hygromycin resistance cassette GFP dropout destination vector as a type 0 part to be used in the MTK systemDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthCLYBL CAS9 Destination - HygroR
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
HF-PX459 (V2)
Plasmid#118632PurposePlasmid encoding SpCas9-HF1, a single guide RNA and puromycin resistanceDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthSpCas9-HF1-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationAsparagine 497 to Alanine, Arginine 661 to Alanin…PromoterCbhAvailable sinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pIVT-dCas9-mCherry
Plasmid#174443Purposein vitro transcription template for dCas9-mCherryDepositorInsertCas9 Endonuclease Dead
UseIn vitro transcription templateTagsmCherryPromoterT7 SP6Available sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
gRNA-eGFP-Reporter
Plasmid#60719PurposeExpresses guide RNA used to activate pGL3-Basic-8x-gRNA-eGFP reporter.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA (5'-AAAGGTCGAGAAACTGCAAA-3')
UseCRISPRExpressionMammalianPromoterU6 and mouse U6Available sinceJan. 30, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJHG003
Plasmid#126454PurposeExpresses Cas9-XTEN-dTdT in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9-XTEN-dTdT (DNTT Human, Streptococcus pyogenes)
ExpressionMammalianMutationAdded D343E and D345E to inactivate TdT.PromoterCMVAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
VPR-ps-dSpCas9
Plasmid#102855PurposeA single-chain light-controllable dSpCas9 with pdDronpa1.2 domainsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdSpCas9, pdDronpa1.2
UseCRISPR and Synthetic BiologyTagsNLS and VP64-p64-Rta transcription activatorExpressionMammalianPromoterPGKAvailable sinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
Nme2Cas9_pCDest
Plasmid#119923PurposeNme2Cas9 CMV-driven mammalian expression plasmidDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNme2Cas9
TagsNLS-3xHA-NLSExpressionMammalianPromoterCMVAvailable sinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MSP2283
Plasmid#70702PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available sinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only