We narrowed to 16,879 results for: Cas9
-
Plasmid#58775PurposeExpresses Cas9 nickase and gRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthumanized S. pyogenes Cas9 (D10A) nickase
UseCRISPRTags3xFLAGExpressionMammalianMutationD10A nickase-converting mutationPromoterCBhAvailable sinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYPQ142
Plasmid#69294PurposeGolden Gate recipient and Gateway entry vector; assembly of 2 gRNAsDepositorTypeEmpty backboneUseCRISPRAvailable sinceNov. 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQ142
Plasmid#69294PurposeGolden Gate recipient and Gateway entry vector; assembly of 2 gRNAsDepositorTypeEmpty backboneUseCRISPRAvailable sinceNov. 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-RSV-SpCas9
Plasmid#85450PurposeExpress SpCas9 in mammalian cellsDepositorHas serviceAAV8InsertpRSV
UseAAVPromoterpRSVAvailable sinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCBC-MT1T2
Plasmid#50593PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, gRNA scaffold, OsU3t plus, TaU3p, T2
UseCRISPR; Pcr templateExpressionPlantAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6d:sgRNA#5
Plasmid#64249Purposeexpresses sgRNA under U6d promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCBC-MT1T2
Plasmid#50593PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, gRNA scaffold, OsU3t plus, TaU3p, T2
UseCRISPR; Pcr templateExpressionPlantAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1-puro U6 sgRNA CAG
Plasmid#50927PurposeU6 driven sgRNA negative controlDepositorInsertnegative control sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
DS-TDcasN-
Plasmid#48660PurposeBacterial nuclease-null TD Cas9 expressionDepositorInsertsCas9, nuclease-null
TD tracrRNA
UseCRISPRMutationD to A, DH to AA, N to APromoterproC and tracrRNA promoterAvailable sinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-Cas9-ScaligD
Plasmid#125688PurposeGene knockout/in for actinomycetesDepositorInsertstreptomyces codon optimized spCas9, sgRNA casette, and ScaligD
UseCRISPR and Synthetic BiologyPromoterermE*/tipAAvailable sinceNov. 21, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-dCas9-D3A
Plasmid#78256PurposeExpresses dead Cas9 (dCas9) fused to DNMT3A catalytic domain (CD) under the control of the CMV promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDNMT3A CD aa 598-912 (DNMT3A Human)
UseCRISPRTagsFlag epitope tagExpressionMammalianPromoterpCMVAvailable sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
zCREST3:Cas9green; T3_gRNA
Plasmid#199335PurposepDEL161; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type III sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertszCREST3
Cas9
nrg1 type III sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-HA-dSpCas9
Plasmid#92112PurposeExpression plasmid for human codon-optimized dead/inactive SpCas9 (without U6-sgRNA coding sequence)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdead/inactive SpCas9
UseCRISPRTagsHA tag and NLSExpressionMammalianMutationD10A, H840APromoterCbhAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1-puro U6 sgRNA CAG
Plasmid#50927PurposeU6 driven sgRNA negative controlDepositorInsertnegative control sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAVS1 gRNAs-Cas9D10A-mRuby
Plasmid#252799PurposePlasmid for paired targeting of AAVS1 locus via Cas9(D10A)nickaseDepositorInsertCas9(D10A)
TagsmRubyExpressionMammalianAvailable sinceMarch 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
dead Sa Cas9
Plasmid#138162PurposeFor orthogonal R loop assay (use with Sp-derived base editor, Sp gRNA, and Sa gRNA for assay)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdSaCas9
TagsNLSExpressionMammalianMutationD10A + N580APromoterCMVAvailable sinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TetO-dCas9-D3A
Plasmid#78254PurposeExpresses dead Cas9 (dCas9) fused to DNMT3A catalytic domain (CD) linked to IRES-mCherry under the control of TetOp and a minimal CMV promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDNMT3A CD aa 598-912 (DNMT3A Human)
UseCRISPRTagsFlag epitope tagExpressionMammalianPromoterCMVAvailable sinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTE_20 - pIVT_CMV-synUTR-inactT7-NLS-Cas9-NLS-XTEN-BARD1-NLS-HbaUTR
Plasmid#252016PurposeIn vitro transcription of Cas9-BARD1 TruEditor for mRNA generationDepositorPublicationInsertCas9-BARD1
UseCRISPRExpressionMammalianMutationNAAvailable sinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTE_22 - pIVT_CMV-synUTR-inactT7-NLS-Cas9-NLS-XTEN-SLX1A-NLS-HbaUTR
Plasmid#252018PurposeIn vitro transcription of Cas9-SLX1A TruEditor for mRNA generationDepositorPublicationInsertCas9-SLX1A
UseCRISPRExpressionMammalianMutationNAAvailable sinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only