We narrowed to 11,254 results for: GFP expression plasmids
-
Plasmid#73988PurposeB108 enhancer of Blimp1 gene drives EGFP expression.DepositorInsertB108 enhancer
ExpressionMammalianAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL3-GFP
Plasmid#67397PurposeMammalian expression of hArl3 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL8B-GFP
Plasmid#67404PurposeMammalian expression of hArl8b with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-SARA-GFP
Plasmid#67410PurposeMammalian expression of hSara with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF6-GFP
Plasmid#67394PurposeMammalian expression of hArf6 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL1-GFP
Plasmid#67395PurposeMammalian expression of hArl1 with C-term GFP tagDepositorInsertARL1 (ARL1 Human)
TagsGFPExpressionMammalianMutationbp 231 C to T; silent mutationPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL6-GFP
Plasmid#67401PurposeMammalian expression of hArl6 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL14-GFP
Plasmid#67406PurposeMammalian expression of hArl14 with C-term GFP tagDepositorInsertARL14 (ARL14 Human)
TagsGFPExpressionMammalianMutationbp 172 C to T; aa L58FPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARFRP1-GFP
Plasmid#67408PurposeMammalian expression of hArfrp with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF1-GFP
Plasmid#67390PurposeMammalian expression of hArf1 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL11-GFP
Plasmid#67407PurposeMammalian expression of hArl11 with C-term GFP tagDepositorInsertARL11 (ARL11 Human)
TagsGFPExpressionMammalianMutationbp 442 T to C; aa C148RPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL4-GFP
Plasmid#67398PurposeMammalian expression of hArl4 with C-term GFP tagDepositorInsertARL4 (ARL4A Human)
TagsGFPExpressionMammalianMutationbp 105 A to T; silent mutationPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF4-GFP
Plasmid#67392PurposeMammalian expression of hArf4 with C-term GFP tagDepositorInsertARF4 (ARF4 Human)
TagsGFPExpressionMammalianMutationV53A, L123P and M134I mutations were unintended P…PromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF3-GFP
Plasmid#67391PurposeMammalian expression of hArf3 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUBC_stdMCP_serinemod_E488QADAR_p2A_yGFP
Plasmid#154787PurposeExpresses synonymized MS2 coat protein dimer (MCP) fused to hyperactive ADAR catalytic domainDepositorInsertAdenosine deaminse (Adar Fly, Synthetic)
UseLentiviralTagsGFP, V5, and stdMCPExpressionMammalianMutationSynonymized serine to prevent autoediting of ADAR…PromoterUBCAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBItetDT960GFP
Plasmid#80419Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 960 interrupted CTG repeats in exon 15 locatedDepositorInsertEGFP and human DMPK exons 11-15 with 960 interrupted CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBItetDT12nGFP
Plasmid#80420Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 12 CTG repeats in exon 15 locatedDepositorInsertEGFP and human DMPK exons 11-15 with 12 CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIM1773-PRHIII-sfGFP-pNW33N
Plasmid#52217PurposeConstitutive sfGFP expression plasmid for use in Geobacillus and E. coliDepositorInsertPRHIII-sfGFP
ExpressionBacterialPromoterPRHIIIAvailable SinceMay 15, 2014AvailabilityAcademic Institutions and Nonprofits only