173,176 results
-
Plasmid#213295PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only
-
NBla_1.2_EmrE_TMD4_3P_G90V_G97V
Plasmid#207847PurposeBLaTM-System; Antiparallel negativecontrol EmrE_TMD4_3P_G90V_G97V in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_EmrE_TMD4_3P
Plasmid#207846PurposeBLaTM-System; Antiparallel positive control EmrE_TMD4_3P in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_GpA_wt
Plasmid#207842PurposeBLaTM-System GpA wt positive control in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
CBLa_1.2_GpA_wt
Plasmid#207843PurposeBLaTM-System GpA wt positive control in CBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251_ Ptrc.x.tetO2::D-HicDH
Plasmid#185456PurposeCDS of D-HicDH codon optimized for expression in Synechocystis sp. PCC 6803 under the control of the synthetic promoter Ptrc.x.tetO2 and the RBS BBa_B0030 in pSEVA251 plasmid.DepositorInsertD-HicDH from Lactobacillus paracasei DSM 20008
ExpressionBacterialPromoterPtrc.x.tetO2Available SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF752
Plasmid#88486PurposeDonor Vector containing ZNF752 transcription factor, part of the Human TFome CollectionDepositorInsertZNF752 (ZFP3 Human)
UseGateway donor vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDZ114
Plasmid#159357PurposeExpresses sfYFP tagged with ssrA from the Pcin promoterDepositorInsertsfYFP
UseSynthetic BiologyPromoterPcinAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-HaloSFPQY527A
Plasmid#166949PurposeLentiviral plasmid expressing Halo-tagged SFPQ Y527A protein from the EF1a promoterDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only