We narrowed to 19,023 results for: Comp;
-
Plasmid#222434PurposeGolden Gate / Green Gate module for adding MiniTurboID and YFP as C-terminus of target protein.DepositorInsertMiniTurboID (BirA mutant)
UseGolden gate / green gate compatible cloning vectorTagsLinker and YFPMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Str-Ii_SBP-EGFP-Golgin84
Plasmid#65303Purposesynchronize trafficking of Golgin-84 from the ER (RUSH system)DepositorInsertGolgin-84 (GOLGA5 Human)
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianPromoterCMVAvailable SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-mCherry-CCR1
Plasmid#222311PurposeSynchronize the trafficking of CCR1 from the ER.DepositorInsertStreptavidin-KDEL and CCR1 fused to SBP-mCherry (CCR1 Human)
ExpressionMammalianPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-TagRFP-OcsT
Plasmid#71270PurposeEntry clone containing TagRFP. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTagRFP
UseGatewayTags4xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGGB_YFP-MiniTurboID
Plasmid#222433PurposeGolden Gate / Green Gate module for adding YFP and MiniTurboID as N-terminus of target protein.DepositorInsertMiniTurboID (BirA mutant)
UseGolden gate / green gate compatible cloning vectorTagsLinker and YFPMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMis1_1B
Plasmid#192079PurposeA pBBR-1 based vector with IncP group plasmid compatibility for expression in Methylorubrum extorquens using rhamnose dependent inductionDepositorInsertsKanR
rhaR
rhaS
pBBR1 rep
ExpressionBacterialAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH_TNF-SBP-EGFP
Plasmid#65282PurposeTNF reporter only (no hook) (RUSH system)DepositorAvailable SinceJune 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH_TNF-SBP-mCherry
Plasmid#65283PurposeTNF reporter only (no hook) (RUSH system)DepositorInsertTNF (TNF Human)
UseLentiviralTagsStreptavidin Binding Protein (SBP) and mCherryPromoterCMVAvailable SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-MS2-HA-HsNot4_AA
Plasmid#148255PurposeMammalian Expression of HsNot4DepositorInsertHsNot4 (CNOT4 Human)
ExpressionMammalianMutationone silent mutation compared to the sequence give…Available SinceNov. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
FLS2-YFPc
Plasmid#87166Purposefluorescence complementation assayDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
FLS2-YFPn
Plasmid#87165Purposefluorescence complementation assayDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRL838
Plasmid#70680PurposeThis vector was used to generate a library of ca. 17-kb sequences of clones as part of a genomic sequence strategy and were then used to complement mutations.DepositorTypeEmpty backboneUseCre/LoxAvailable SinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsDCP1a_G
Plasmid#146400PurposeMammalian Expression of HsDcp1aDepositorInsertHsDcp1a (DCP1A Human)
ExpressionMammalianMutationtwo silent mutations T237C and G1716T compared to…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-HsNot4-GB1His6_AG
Plasmid#148792PurposeBacterial Expression of HsNot4DepositorInsertHsNot4 (CNOT4 Human)
ExpressionBacterialMutationone silent mutation compared to the sequence give…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry
Plasmid#210504Purposeexpresses NES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry component in mammalian cellsDepositorInsertNES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry
ExpressionMammalianAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ oDam_f_GFPoNLS
Plasmid#85819PurposeiDamID plasmid. To express transiently the optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertoDam_f_GFPoNLS
TagsoNLS (optimized nuclear localization signal) C te…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PatoM-LOG241
Plasmid#72847PurposeInduced by acetoacetate to express GFP using atoSC two-component system in E. coli. Contains the atoDAEB promoter (Pato) with a strong RBS, Shine-Dalgarno sequence provided in OG241. LOG241 backbone.DepositorInsertPatoM
ExpressionBacterialPromoterPatoMAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only