We narrowed to 36,584 results for: puro
-
Plasmid#191951PurposeExpression of CFP-Bax chimeraDepositorInsertCFP-Bax
UseRetroviralAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCVpuro-CFP-Bax
Plasmid#191951PurposeExpression of CFP-Bax chimeraDepositorInsertCFP-Bax
UseRetroviralAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCVpuro-Bax-YFP
Plasmid#191941PurposeExogenous expression of a Bax-YFP chimera.DepositorInsertBax-YFP
UseRetroviralAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCVpuro-Bax-YFP
Plasmid#191941PurposeExogenous expression of a Bax-YFP chimera.DepositorInsertBax-YFP
UseRetroviralAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-mCherry-HRasCT
Plasmid#186704PurposeEncoding membrane-targeted mCherryDepositorInsertmCherry-HRasCT
ExpressionMammalianAvailable SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-mCherry-HRasCT
Plasmid#186704PurposeEncoding membrane-targeted mCherryDepositorInsertmCherry-HRasCT
ExpressionMammalianAvailable SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform2_untagged-Puro
Plasmid#192002PurposeLentiviral vector to generate LYSET(TMEM251)-isoform2 stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform2_untagged-Puro
Plasmid#192002PurposeLentiviral vector to generate LYSET(TMEM251)-isoform2 stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform1_I142V-Puro
Plasmid#192004PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 I142V mutant stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform1_I142V-Puro
Plasmid#192004PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 I142V mutant stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform1_R45W-Puro
Plasmid#192003PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 R45W mutant stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform1_R45W-Puro
Plasmid#192003PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 R45W mutant stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2333_Tier3(Lenti_inverse)-YPet_Puro
Plasmid#169664PurposeTier-3 vector for stable integration via lentiviral transduction in inverted direction with polyA carrying a constitutive expression cassette for puromyine and Ypet (PCMV-5'LTR-Psi-gag-env-PRPBSA-YPet-p2A-PuroR-pA::A2-pA::A3-pA-WPRE-3'LTR)DepositorInsertPRPBSA-driven YPet and PuroR expression
ExpressionMammalianPromoterPhCMV / RPBSAAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2333_Tier3(Lenti_inverse)-YPet_Puro
Plasmid#169664PurposeTier-3 vector for stable integration via lentiviral transduction in inverted direction with polyA carrying a constitutive expression cassette for puromyine and Ypet (PCMV-5'LTR-Psi-gag-env-PRPBSA-YPet-p2A-PuroR-pA::A2-pA::A3-pA-WPRE-3'LTR)DepositorInsertPRPBSA-driven YPet and PuroR expression
ExpressionMammalianPromoterPhCMV / RPBSAAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2361_Tier3(SB)-rtTA-YPet_PuroR
Plasmid#169657PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a YPet marker and PuroR resistance gene and a PPGK-driven rtTA transactivator (5'ITR-A1-pA::PPGK-rtTA-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR)DepositorInsertPPGK-driven rtTA expression and PRPBSA-driven YPet and PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2361_Tier3(SB)-rtTA-YPet_PuroR
Plasmid#169657PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a YPet marker and PuroR resistance gene and a PPGK-driven rtTA transactivator (5'ITR-A1-pA::PPGK-rtTA-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR)DepositorInsertPPGK-driven rtTA expression and PRPBSA-driven YPet and PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2363_Tier3(PB)-rtTA-YPet_PuroR
Plasmid#169659PurposeTier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a YPet marker and PuroR resistance gene and a PPGK-driven rtTA transactivator (5'ITR-A1-pA::PPGK-rtTA-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR)DepositorInsertPPGK-driven rtTA expression and PRPBSA-driven YPet and PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2363_Tier3(PB)-rtTA-YPet_PuroR
Plasmid#169659PurposeTier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a YPet marker and PuroR resistance gene and a PPGK-driven rtTA transactivator (5'ITR-A1-pA::PPGK-rtTA-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR)DepositorInsertPPGK-driven rtTA expression and PRPBSA-driven YPet and PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only