We narrowed to 2,470 results for: 1186
-
Plasmid#1186DepositorAvailable SinceAvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
PX459v3-SpCas9-HF1
Plasmid#178801PurposeHigh-fidelity SpCas9-HF1 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1663 - pAAV SYN1 mGas6-Myc-DDK
Plasmid#202540PurposeAn adeno-associated viral vector expressing murine Gas6 fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
SITS-EGFP-Bin1b
Plasmid#176021PurposeLeishmania cell free expression of zebrafish EGFP-Bin1b. Parton lab clone GRSDepositorAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T646A
Plasmid#74937PurposeMammalian expression of human NSF mutant T646A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
TagsFLAGExpressionMammalianMutationT646A (mutation in the D2 domain of the protein)PromoterCMVAvailable SinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
Plasmid#115694PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.DepositorInsertsNmeCas9
Nme-sgRNA
UseCRISPRTagsNLS and NLS, HAExpressionInsect and MammalianMutationNone and fusion of repeat/tracrRNA to make a sgRNAPromoterEF-1 alpha and U6Available SinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSC-LHX8-IRES-GBX1
Plasmid#182235PurposeTo convert human skin fibroblasts into induced basal forebrain cholinergic neurons (hiBFCNs) in combination with ASCL1, Sox11, FGF2 and two small molecules, forskolin and LDN-193189DepositorAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX_TRC311/NLS-Cas13d-P2A-Blast
Plasmid#212196PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-Blasticidin for RNA targeting. CasRx-2A-Blasticidin is driven by EF1a promoter. EGFP is driven by SV40DepositorInsertCasRx (NLS-RfxCas13d-NLS)-HA with 2A-Blasticidin
UseCRISPR and LentiviralTagsHA, NLS, and blasticidin S deaminaseExpressionMammalianPromoterEF-1α promoterAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 hMOG-alpha1-EGFP
Plasmid#126463PurposeExpression a human MOG (isoform alpha1) EGFP fusion protein in mammalian cellsDepositorAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-RANGAP.C-linker.miniIAA7.3xFlag.P2A.BSD
Plasmid#216248PurposeHDR template to tag endogenous human RANGAP1 C-terminus with miniIAA7.3xFlag.P2A.BSDDepositorInsertHDR template for human RANGAP1 (RANGAP1 Human)
UseCRISPR and TALEN; Hdr templateTagsminiIAA7.3xFlag.P2A.BSDExpressionMammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHEE401
Plasmid#71286PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertssgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 promoter and U6-26p Arabidopsis U6 gene pro…Available SinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-SEC61B.N-BSD.P2A.miniIAA7.3xFlag
Plasmid#216250PurposeHDR template to tag endogenous human SEC61B N-terminus with BSD.P2A.miniIAA7.3xFlagDepositorInsertHDR template for human SEC61B (SEC61B HDR template, Human, Synthetic)
UseCRISPR; Hdr templateTagsBSD.P2A.miniIAA7.3xFlagExpressionMammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGMC00005
Plasmid#166722PurposesgRNA against human ASNSDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGMC00006
Plasmid#166723PurposesgRNA against human ASNSDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
3'-ecRESCUE-mCherry
Plasmid#191486PurposeecDHFR DD-mCherry, an inducible ecRESCUE RNA base editor: TMP-induced ecDHFR DD expression allows reversible control of the expression of dRanCas13b-ADAR2-mCherryDepositorUseCRISPRExpressionMammalianPromoterCMVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdCas9 (GB1079)
Plasmid#75399PurposeProvides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid part for C-terminal fusionsDepositorInsertCas9 coding region with mutated (D10A, H840A) and inactivated catalytic domains (human codon optimised)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCW57-Cx32-IRES-GCaMP6s
Plasmid#216795PurposeInducible bicistronic lentiviral plasmid for the simultaneous expression of Connexin 32 and cytosolic GCaMP6sDepositorInsertConnexin 32-IRES-GCaMP6s (GJB1 Human)
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-EGFP-IRES2-CRY2-STIM1(238-448)
Plasmid#248295PurposeAn expression construct encoding a CRY2-fused STIM1 fragment (a.a.238-448) linked to EGFP through an IRES2 element.DepositorInsertEGFP and CRY2-fused STIM1 fragment (a.a.238-448) (STIM1 )
TagsEGFPMutationdeleted amino acids 1-237,449-685PromoterCMVAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only