We narrowed to 13,846 results for: cas9
-
-
lenti-Cas9-Exo-Blast-BFP
Plasmid#196721PurposeSortable and selectable SpCas9 fused to exodeoxyribonuclease I (sbcB) from E. coli. For the creation of longer deletions.DepositorInsertCas9-Exo1-T2A-BSD-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSExpressionMutationPromoterEF1aAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-gRNA(SFTPCI73Tcorr)-SpCas9(BB)-2A-GFP
Plasmid#187647PurposeEncodes gRNA to correct the SFTPC I73T mutationDepositorInsertI73T gRNA
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICH47811-pAtAct2::Cas9-nls::tSlATPase
Plasmid#160221PurposeCas9-nuclear localization, pACT2 promoter, SlATPase terminator transcriptional unit, inserted at the MoClo toolkit level 1 acceptor position 2 reverseDepositorInsertpAtACT2::Cas9-nls::tSlATPase
UseSynthetic Biology; Moclo toolkit level 1 acceptor…TagsExpressionPlantMutationPromoterAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Easy-Cas9-nls-CDS1
Plasmid#160231PurposeCas9-nuclear localization, level 0 of MoClo Golden Gate position CDS1DepositorInsertCas9-nuclear localization signal gene sequence, Golden Gate MoClo position CDS1
UseLevel 0 of moclo golden gate position cds1TagsExpressionMutationPromoterAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH321-1-Tier1-PhCMV-dCas9-3xNLS
Plasmid#169595PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS expression (PhCMV-dCas9-3xNLS-pA).DepositorInsertdead S.pyogenes Cas9
UseTagsExpressionMammalianMutationPromoterPhCMVAvailable sinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCC_162 SpCas9 KES(1107-1109)GG
Plasmid#179526PurposeFor bacterial expression of SpCas9 KES(1107-1109)GG (phosphate lock loop mutant) with an N-terminal His-MBP tagDepositorInsertSpCas9 KES(1107-1109)GG
UseTags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationreplaced KES (residues 1107-1109) with GGPromoterAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-p300 core
Plasmid#179558Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human CBP core (aa 1084-1701) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP RING-PHD-HAT
Plasmid#179549Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 RING-PHD-HAT
Plasmid#179546Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-B2
Plasmid#165083PurposegRNA 2 of pair B for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C1
Plasmid#165085PurposegRNA 1 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C2
Plasmid#165086PurposegRNA 2 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-TREX1 g3 Cas9-T2A-mCherry
Plasmid#164252PurposeTranscription of TREX1 guide RNA and Cas9 expression for CRISPR/Cas9 in mammalian cellsDepositorInsertsgTREX1
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only
