We narrowed to 14,321 results for: cas9
-
Plasmid#102917Purposeexpresses ABE7.8 in mammalian cellsDepositorInsertABE7.8
TagsNLSExpressionMammalianMutationsee manuscriptPromoterCMVAvailable sinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
HEK4-53bp-tag-insertion-pegRNA
Plasmid#227673PurposePegRNA for 53 bp insertionDepositorAvailable sinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTox-EGFPsite1_NGG-PAM (BPK740)
Plasmid#181746Purposep11-lacY-wtx1 derivative toxic plasmid encoding an SpCas9 target site for EGFP site 1 with an NGG PAMDepositorInsertccdB toxin gene and SpCas9 target site (EGFP site 1 NGG PAM)
UseSelection plasmidAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSH231-EFS-Cas9-BlastR
Plasmid#115146PurposeSafe harbor site 231 knock-in vector with Cas9-BlastR expression cassetteDepositorInsertCas9-T2A-BlastR
UseCRISPRExpressionMammalianPromoterEF1aAvailable sinceOct. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCas9/VRQR-sgRNA (BbsI)
Plasmid#129725PurposeExpressing SpCas9/VRQR mutant and sgRNA for target sequence with NGA PAMDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1-dCas9-dMQ1-EGFP
Plasmid#89637PurposeTargeted CpG methylationDepositorInsertsite-specific DNA-methyltransferase SssI
UseCRISPRTags3*FLAG, 6*His, and T2A-EGFPExpressionMammalianMutationC141S, TGC-->TCC; S317A, AGC-->GCCPromoterCMVAvailable sinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p221z-CAS9p-t35s
Plasmid#118385PurposeEntry clone containing CAS9p and 35S terminator. Used to make CRISPR construct . For use in plants and compatible with the MultiSite Gateway systemDepositorInsertCAS9p
UseCRISPRAvailable sinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGE78
Plasmid#80580Purposerecipient plasmid [multiplexing, nickase]; pPcUbi:Cas9 D10A, nptIIDepositorInsertspnos:nptII-tmos
pPcUbi:Cas9 D10A-tnos
BsaI-ccdB_CmR-BsaI
UseCRISPRExpressionPlantMutationD10AAvailable sinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
GeneWeld Vectors for Targeted Integration Using CRISPR/Cas9
Plasmid kit#1000000154PurposeTargeted genome integration in human cells, zebrafish embryos, and pig fibroblasts.DepositorApplicationGenome EditingVector typeMammalian Expression, Zebrafish ExpressionEditing typeCRISPRAvailable sinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGrin1
Plasmid#124852PurposeMutagenesis of Grin1DepositorInsertGrin1 (Grin1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJCHph
Plasmid#185863PurposeThe CRISPR/Cas9-and-gRNA-expressing plasmid with a hygromycin B-resistent selectable markerDepositorInsertPTDH3-Cas9(N); PSNR52-srRNA-TSUP4; HphMX6
ExpressionYeastMutationNoneAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3
Plasmid#86611PurposeExpresses the ATP1A1 G3 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 4. Px330-like plasmidDepositorInsertATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1-dCas9-MQ1(WT)-EGFP
Plasmid#89633PurposeTargeted CpG methylationDepositorInsertsite-specific DNA-methyltransferase SssI
UseCRISPRTags3*FLAG and 6*HisExpressionMammalianPromoterCMVAvailable sinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
iPEmax-WT
Plasmid#239385PurposeFor inverse prime editor using Cas9-R221K-N394K in HEK294T cellsDepositorInsertCas9-R221K-N393K, M-MLV-RT
UseCRISPRTagsBPNLS and SV40 NLS, c-myc NLSExpressionMammalianMutationR221K, N394K in Cas9PromoterCMVAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-TRE3G-dCas9-HaloTag
Plasmid#169448Purposeexpression of dCas9-HaloTagDepositorInsertdCas9-HaloTag
UseLentiviralExpressionMammalianAvailable sinceJune 13, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LLP185 pLVP-dCas9-DNMT3a V2
Plasmid#100936PurposedCas9 and DNMT WT on C terminus, 4 NLS, driven by pGK promoter, with P2A site and PURO gene, within a lentiviral transfer backboneDepositorInsertdCas9, DNMT3a catalytic domain (DNMT3A S.pyogenes, Human)
UseCRISPR and LentiviralTags3xHA and 3xTy1ExpressionMammalianMutationD10A, H840A for dCas9Available sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYN2_1
Plasmid#184757PurposePlasmid for genome editing by CRISPR/Cas9DepositorInsertsCas9
sgRNA scaffold where sfGFP is replaced with gRNA protospacer of interest, which will be proceeded by the HDV Ribozyme
UseSynthetic BiologyTags2xNLSExpressionBacterial and YeastPromoterPGK1 and tRNA-Phe-HDV RibozymeAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-EN1082_Rad21_STOP
Plasmid#156450PurposeFor transient expression of Cas9 and sgRNA targeting mouse RAD21 stop codonDepositorAvailable sinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by