We narrowed to 16,166 results for: grna
-
Plasmid#173570PurposeExpresses a Arhgap35-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arhgap35 (Grlf1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceApril 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgArhgap35#1/Cre
Plasmid#173569PurposeExpresses a Arhgap35-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arhgap35 (Grlf1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceApril 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFH113
Plasmid#128210Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML45
Plasmid#206995PurposeContains gRNA targeting mouse Ptbp1 gene and Cas9 ORF.DepositorAvailable sinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
RUBY-ABE#2
Plasmid#232176PurposeT-DNA vector with ecTadA8e-zCas9D10A and corresponding sgRNA to correct RUBYm2 and recover a vivid red color visible to the naked eyes.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-sgRNA-mis4-gRNA scaffold
UseCRISPRTags3xflag and NLSExpressionPlantAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT59
Plasmid#223431PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT15
Plasmid#223387PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by 2x35s and the sgRNA was driven by AtU3 promoter.DepositorInsert2x35s-hA3A-Y130F-SpCas9-D10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT17
Plasmid#223389PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpCas9-D10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiSF3B1
Plasmid#202446PurposeExpression of a CRISPRi guide targeting SF3B1DepositorAvailable sinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Ski-gRNA2
Plasmid#180369Purposetargeting mouse Ski geneDepositorAvailable sinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHBS952 TARDBP-Exon1-ko-sgRNA1-SpCas9
Plasmid#107857PurposeTo knock-out TDP43DepositorInsertgRNA against TARDBP (Exon 1) (TARDBP Human)
ExpressionMammalianAvailable sinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSS2.1-Cas9-HH-gRNADhps-HDV
Plasmid#241015PurposeCas9 expression cassette encoding a guide RNA targeting the Dhps locus, flanked by a hammerhead (HH) ribozyme at the 5′ end and a hepatitis delta virus (HDV) ribozyme at the 3′ endDepositorInsertsCas9-Hammerhead (HH) Ribozyme-gRNA(Dhps)-Hepatitis Delta Virus (HDV) Ribozyme
blasticidin-S deaminase
ExpressionYeastAvailable sinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgArid1b#2/Cre
Plasmid#173574PurposeExpresses a Arid1b-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arid1b (Arid1b Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgArid1b#1/Cre
Plasmid#173573PurposeExpresses a Arid1b-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arid1b (Arid1b Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNcor1#2/Cre
Plasmid#173606PurposeExpresses a Ncor1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ncor1 (Ncor1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
gRNA[Tra].1026G
Plasmid#112689Purposeexpress gRNA targeting Tra under dU6-3 promoterDepositorInsertU6.3-gRNA[Tra] (tra Fly)
UseCRISPRAvailable sinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2616
Plasmid#91090PurposeModule C, Promoter: At7SL, Gene: BsaI ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertBsaI ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterAt7SLAvailable sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#2
Plasmid#107730PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#1
Plasmid#107729PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by