We narrowed to 714 results for: gcg.2
-
Plasmid#227473Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 11kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-3.3kb-USF
Plasmid#227475Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 3.3kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-58kb-USF
Plasmid#227457Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 58kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR CAMK1D TSS-guide4
Plasmid#118180PurposeCRISPR-mediated repression of CAMK1D. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
1056H
Plasmid#183135PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056J
Plasmid#183136PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
ACE2 g2
Plasmid#153012PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing mCherryDepositorAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-14kb-USF-1-6
Plasmid#227470Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCFD5-frame_selector_0,1,2
Plasmid#131152PurposeDrosophila expression of frame selector sgRNAs 0,1, and 2 that target the CRISPaint site for homology-independent knock-inDepositorInsertCRISPaint frame selector sgRNAs 0,1,2
UseCRISPRExpressionInsectPromoterdU6:3Available SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS2
Plasmid#174302PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #2 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgNotch2#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209069PurposeEntry vector that encodes sgRNAs against mouse Notch2, Rb1, Trp53, Rbl2, and CMV Cre recombinase.DepositorInsertsgRNAs targeting Notch2, Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionPromoterU6Available SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-L3US2-RFP-HDAC3
Plasmid#83966PurposeLentiviral CRISPR HDAC3 dual gRNA targeting vectorDepositorAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasWT/sgKras/Cre
Plasmid#99848PurposeExpresses Cre-recombinase, a barcoded HDR template that serves as a control for HDR into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
ACE2 g1 + Cas9
Plasmid#153011PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2DepositorAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasWT/sgKras/Cre
Plasmid#99848PurposeExpresses Cre-recombinase, a barcoded HDR template that serves as a control for HDR into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 CAMK1D TSS-guide2
Plasmid#118193PurposeCRISPR-mediated activation of CAMK1D. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-L3US2-RFP-HDAC3
Plasmid#83966PurposeLentiviral CRISPR HDAC3 dual gRNA targeting vectorDepositorAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 CAMK1D TSS-guide2
Plasmid#118193PurposeCRISPR-mediated activation of CAMK1D. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–T1gRNA
Plasmid#62717Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only