We narrowed to 16,804 results for: OMP;
-
Plasmid#27499DepositorAvailable sinceMarch 1, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
pOZ-N-FH MERIT40
Plasmid#27498DepositorAvailable sinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CD-MPR-mCherry-RUSH
Plasmid#202798PurposeRUSH cargo: Str-KDEL_IRES_SBP-mCherry-CD-MPRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertM6PR (M6PR Human)
TagsmCherryExpressionMammalianMutationChanged 40 K (AAA) with R (AGA)PromoterCMVAvailable sinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMT-Mef2c-tPT2A-GFP
Plasmid#111771PurposeBicistronic construct: Co-express two genes by 2A peptidesDepositorAvailable sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
mNeonGreen-UtrCH
Plasmid#98879PurposeIn vivo visualization of actin cytoskeleton (can be used for colocalization studies)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertUtrCH
TagsmNeonGreenExpressionMammalianMutation*(see below)PromoterCMVAvailable sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQ166
Plasmid#109328PurposeGateway entry plasmid (attL1 & attR5) expressing 3_FLAG-NLS-zCas9-NLS without promoterDepositorInsertzCas9
UseCRISPR; Gateway compatible zcas9 entry cloneTags3x FLAG, NLS and NLSExpressionPlantMutationZea mays codon-optimized Cas9Available sinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKK-TEV-mRuby3
Plasmid#105797PurposeExpression of your protein of interest in fusion with red fluorescent protein at the C-terminus (cleavable by TEV) (PMID: 26879144). mRuby3 is brighter than mCherry and has shifted ex and em spectra.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mRuby3ExpressionMammalianAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJW1507
Plasmid#62361PurposepFA6a -mVenus-BirA::HIS5DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertc-terminal mVenus-BirA tagging
UseYeast c-terminal tagging vectorTagsmVenus-BirAMutationL232H mutation compared to standard mVenusAvailable sinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA-Nup37-EGFP-polyA
Plasmid#104562PurposeExpress Nup37-EGFP in mammalian cells (CMV promoter). Also suitable for in vitro transcription (T7 promoter) for injecting mRNA into oocytes.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNup37 (Nup37 Mouse)
TagsEGFP tagExpressionMammalianAvailable sinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-
pGGZ003
Plasmid#48869PurposeEmpty destination vector for creating a GreenGate plant transformation plasmid with the plant resistance cassette at the T-DNA left border.DepositorTypeEmpty backboneUseGolden gate compatible plant transformation vectorAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLQ9715: pHR-PGK-SV40_NLS-dCasMINI-V4-NFZ-c-Myc_NLS-mCherry-WPRE
Plasmid#203221PurposeExpression of dCasMINI-V4-NFZ-mCherry in mammalian cellsDepositorInsertdCasMINI-V4-NFZ-mCherry
UseCRISPR and LentiviralExpressionMammalianPromoterPGKAvailable sinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHis APEX2-eIF4A1
Plasmid#129645PurposeExpress APEX2 fusion to DEAD-box translation factor eIF4A1 in bacteriaDepositorInserteukaryotic translation initiation factor 4A1 (EIF4A1 Human)
Tags6xHis and APEX2ExpressionBacterialAvailable sinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pACEBac1-CoRESTfl
Plasmid#109156PurposeEncodes human full-length CoREST with C-terminal 3xFLAG tag to be expressed in a baculovirus/insect cell expression systemDepositorInserthuman full-length CoREST, sequence-optimized for insect cells (RCOR1 Human)
Tags3xFLAGExpressionInsectPromoterPolyhedrinAvailable sinceJan. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-NPM NLS2D
Plasmid#13285DepositorAvailable sinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pBT2dR3-proB
Plasmid#122595PurposeBE PACE selection, express T7 RNA polymerase with degron-GTCCA targetDepositorInsertT7 RNA polymerase
UseSynthetic BiologyAvailable sinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIC113
Plasmid#44434DepositorTypeEmpty backboneUseRetroviralTagsEGFP, s peptide, and tevExpressionMammalianAvailable sinceApril 26, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQsupR-Mi2b
Plasmid#15379DepositorInsertshort hairpin RNA against mouse Mi-2 beta (Chd4 Mouse)
UseRNAi and RetroviralAvailable sinceApril 18, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by