We narrowed to 9,206 results for: sgRNA
-
Plasmid#137730PurposeExpresses customizable S. Pyogenes sgRNA from U6 promoter and PuroR-P2A-EGFP from EF-1a promoter. Stuffer contains mRFP from a bacterial promoter, enabling simple visual quality control step of sgRNADepositorTypeEmpty backboneUseCRISPR, Lentiviral, Mouse Targeting, and Syntheti…ExpressionBacterial and MammalianAvailable sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pSLQ5004_hU6_sgRNA targeting e4
Plasmid#190686PurposesgRNA targeting enhancer 4 of MYCDepositorInsertsgRNA targeting enhancer 4 of MYC (MYC Human)
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromoterHuman U6 promoterAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1373_mU6_sgRNA targeting e3
Plasmid#190685PurposesgRNA targeting enhancer 3 of MYCDepositorInsertsgRNA targeting enhancer 3 of MYC (MYC Human)
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromotermouse U6 promoterAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold L5-L2
Plasmid#62130PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR and Gateway CloningExpressionMammalianAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330_Tuba1b sgRNA / hSpCas9
Plasmid#172835PurposeMammalian expression of a sgRNA targeting the intron 1 of Tuba1b (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Tuba1b under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i1 sgRNA / hSpCas9
Plasmid#172825PurposeMammalian expression of a sgRNA targeting the intron 1 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_rSyn1 sgRNA / hSpCas9
Plasmid#172840PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of rSyn1 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of rSyn1 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_rActb sgRNA / hSpCas9
Plasmid#172833PurposeMammalian expression of a sgRNA targeting the intron 1of rat Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of rActb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 kif26b sgRNA1
Plasmid#102857PurposeExpresses sgRNA targeting mouse Kif26bDepositorInsertMouse Kif26b (Kif26b Mouse)
UseLentiviralAvailable sinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 kif26b sgRNA2
Plasmid#102858PurposeExpresses sgRNA targeting mouse Kif26bDepositorInsertMouse Kif26b (Kif26b Mouse)
UseLentiviralAvailable sinceDec. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ACTB_sgRNA
Plasmid#183884PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-RHOA_sgRNA
Plasmid#183877PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and RHOA sgRNA for N-terminal tagging of RhoA in human cells.DepositorAvailable sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
LV-U6-sgRNAfiller-PGK-Cre-EFS-mScarletSIIN
Plasmid#172436PurposeLentivirus, expresses Cre recombinase and mScarlet-SIINFEKL, with sgRNA cloning siteDepositorInsertsCre
mScarlet-SIINFEKL(OVA257-264)+Ova 323-339
UseCRISPR and LentiviralAvailable sinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-wtSpCas9 (without sgRNA)
Plasmid#92353PurposeExpression plasmid for human codon-optimized wild-type SpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFlag-NLS-wild-type SpCas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCbhAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only