We narrowed to 8,392 results for: crispr grnas
-
Plasmid#76635Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAA2DepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only
-
GSK3A gRNA (BRDN0001148594)
Plasmid#76370Purpose3rd generation lentiviral gRNA plasmid targeting human GSK3ADepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
GNE gRNA (BRDN0001145858)
Plasmid#77830Purpose3rd generation lentiviral gRNA plasmid targeting human GNEDepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
Neg. Ctrl_sgRNA
Plasmid#111298PurposeCRISPR KO murine neg. ctrl.DepositorInsertNegCtrl sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
MsCLYBL_sgRNA1
Plasmid#111294PurposeCRISPR KO murine CLYBLDepositorInsertsgRNA1 against murine CLYBL
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#3
Plasmid#107731PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#3
Plasmid#107728PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN460
Plasmid#137878PurposePiggyBac vector for expression of 1x gRNA targeting POGZ for CRISPRa;mRFP-T2A-BlasticidinRDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1045B
Plasmid#125004PurposeExpresses gRNAs targeting hid, eve, and hedgehogDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1045D
Plasmid#125006PurposeExpresses gRNAs targeting hedgehog and winglessDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1045A
Plasmid#125003PurposeExpresses gRNAs targeting hid and eveDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHU6_Ch5_155183064-gRNA-for
Plasmid#81214PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 3' region of pCALNL_Ch5 reporterDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_Ch5_155183064-gRNA-rev
Plasmid#81215PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 5' region of pCALNL_Ch5 reporterDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC41
Plasmid#62332PurposesgRNA (no RNA aptamer addition) with PCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
PCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-gRNA(anti-sense) hUbC-VP64-dCas9-VP64-T2A-GFP
Plasmid#66707Purposeexpresses a single gRNA and VP64-dCas9-VP64DepositorInsertshU6-gRNA expression cassette
S.Pyogenes VP64-dCas9-VP64
UseLentiviral and Synthetic BiologyTagsVP64MutationD10A and H840APromoterhU6 and hUbCAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
1518_pAAV-U6-SA-eGFP-gRNA-HLP-SACas9-HA-OLLAS-spA
Plasmid#109316PurposePlasmid for liver-specific expression of AAV SaCas9 with a gRNA against eGFPDepositorInserteGFP gRNA
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA(MS2)_Prnp_SAM2
Plasmid#78625PurposeEncodes sgRNA2.0 targeting 138nt upstream of TSSDepositorAvailable SinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA(MS2)_Prnp_SAM1
Plasmid#78624PurposeEncodes sgRNA2.0 targeting 158nt upstream of TSSDepositorAvailable SinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
SiC-V2-Cas9G7
Plasmid#133043PurposeDoxycycline-inducible SiC-V2 vector with Cas9G7 (sgRNA 7 targeting SpCas9 gene). In cells coexpressing Cas9 nuclease, this construct causes self-inactivation/editing of SpCas9 gene upon Dox addition.DepositorInsertTet repressor
UseLentiviralTagsCeruleanAvailable SinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Pou5f1-g2)-PGKpuroBFP-W
Plasmid#105036PurposeLentiviral gRNA plasmid targeting mouse Pou5f1 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only