We narrowed to 14,273 results for: cas9
-
Plasmid#115147PurposeSafe harbor site 231 knock-in vector with BlastR-Cas9-VPR expression cassetteDepositorInsertBlastR-P2A-Cas9-VPR
UseCRISPRTagsSV40NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
Wei lab paired-guide RNA (pgRNA) CRISPR–Cas9 library for human long non-coding RNAs (lncRNAs)
Pooled Library#89640PurposeDesigned for genomic deletion screening of functional lncRNAs (long non-coding RNAs) using lentiviral pgRNAs (paired-guide RNAs).DepositorExpressionMammalianUseLentiviralAvailable SinceMay 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
GS2.1/EC
Plasmid#132568PurposesgRNA targeting A. thaliana pds3, regulated by A. thaliana U6 polIII promoter. Cas9 with a C-terminal mApple fusion, egg cell-specific expression. Hygromycin selectable marker (hpt).DepositorInsertegg cell promoter, Cas9-mApple, pds3 sgRNA
UseCRISPR and Synthetic BiologyExpressionPlantPromoterA. thaliana egg cell promoterAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459-TP53-exon5
Plasmid#217456PurposeFor TP53 knockout targeting exon 5 of TP53DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459-TP53-exon4
Plasmid#217455PurposeFor TP53 knockout targeting exon 4 of TP53DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDD426
Plasmid#202079PurposeFrame +1/-0 selector for NHEJ knock-inDepositorInsertpEF1a-mCherry-Cas9 + Frame +1/-0 sgRNA
UseCRISPRPromoterEF1aAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA128 A2UCOE-HBB_IVS2-Cas9-BFP
Plasmid#249152PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-HBB_IVS2-Cas9-TagBFP (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEN243-KH217
Plasmid#224550PurposeCas9-2A-puro and sgRNA targeting the STOP codon mouse Car2DepositorInsertCas9 and sgRNA targeting the STOP codon of mouse CAR2 (Car2 Mouse)
UseCRISPRExpressionMammalianAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJT259 Lenti pEF-dCas9-3XFLAG-VP64-T2A-tagBFP-P2A-Blast
Plasmid#187335PurposedCas9 effector fusion for manipulating transcriptionDepositorInsertCas9-3XFLAG-VP64-T2A-tagBFP-P2A-Blast
UseCRISPR and LentiviralTags3XFLAGExpressionMammalianPromoterpEF1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2814 pPB: CAG-Puro-WPRE PGK-VPR-tagBFP-SpdCas9
Plasmid#84247PurposeExpresses direct fusion VPR-Sp dCas9DepositorInsertsVPR-tagBFP-Sp dCas9
Puro
UseCRISPR and Synthetic Biology; PiggybacTags2xNLS (SV40), HA tag, VPR, and tagBFPExpressionMammalianPromoterCAG and PGKAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pICSL11197
Plasmid#191784PurposeSpCas9 expression in plantsDepositorInsertAtUbi10::Cas9 +13 introns-T-E9
UseCRISPRExpressionPlantAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA TdL
Plasmid#80938PurposeExpresses Cas9N in mammalian cells; expresses gRNA TdL for Ai9 cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDD427
Plasmid#202080PurposeFrame +2/-1 selector for NHEJ knock-inDepositorInsertpEF1a-mCherry-Cas9 + Frame +2/-1 sgRNA
UseCRISPRPromoterEF1aAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA100
Plasmid#245322PurposeCas9 CRISPRko all-in-one positive control; targets CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2812 pPB: CAG-GID1-VPR-IRES-Puro-WPRE PGK-GAI-tagBFP-SpdCas9
Plasmid#84240PurposeExpresses GA-inducible VPR-Sp dCas9DepositorInsertsGAI-tagBFP-Sp dCas9
GID1-VPR
UseCRISPR and Synthetic Biology; PiggybacTags2xNLS (SV40), GAI, GID1, HA tag, IRES-Puro, and t…ExpressionMammalianPromoterCAG and PGKAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
Bassik lab Mouse CRISPR-Cas9 Deletion Library - Trafficking, mitochondrial, motility
Pooled Library#1000000126PurposeCRISPR gRNA mouse knockout pooled library - Trafficking, mitochondrial, and motilityDepositorAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJK413
Plasmid#155372PurposedCas9 oscillator v1 (dCRv1) + [dCas9 + PA4-mVenus] (sgRNAs flip of 412)DepositorInsertsdCas9 (bacteria)
PA4-mVenus
dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)Available SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only