We narrowed to 7,002 results for: tac
-
Plasmid#220068Purposeoverexpreeses the TGN protein GRIP with a mCherry fluorophoreDepositorInsertGOLGA4-GRIP (GOLGA4 Human)
ExpressionMammalianAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBRα-σ70 D581G
Plasmid#53732PurposePlpp/PlacUV5- directed synthesis of the alpha NTD fused to E. coli σ70 region 4. Used as two-hybrid control. For cloning purposes, see Addgene plasmid 53734.DepositorInsertRNAP alpha NTD (aa 1-248) fused to E. coli sigma 70 (aa 528-613)
ExpressionBacterialMutationThe sigma 70 moiety carries the D581G substitutionPromoterlpp/lacUV5 (tandem promoter)Available SinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
LVDP 2P.2
Plasmid#231904PurposeFor the production of SARS-CoV-2 virus-like particles (VLPs) in the '2-plasmid' system and packaging firefly luciferase mRNA into the VLPsDepositorUseLentiviralMutationR203M in N proteinPromoterCMV, EF-1aAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV_Tre3g_CalcireticulinSS_mTurquoise_D4-cameleon_REAch2_KDEL
Plasmid#216253PurposeFRET-based calcium sensor located in the ER lumen, Tet-inducibleDepositorInsertER-targeted D4 second generation cameleon (FRET calcium sensor)
UseLentiviralTagsREAch and mTurquoisePromoterTRE3GAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
LacZ-5BoxB in pcDNA3.1+
Plasmid#29729DepositorInsertLacZ-5BoxB
ExpressionMammalianAvailable SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEY41
Plasmid#191045Purposedat-1 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-tagRFP-Mad2
Plasmid#114021PurposeLentiviral delivery of tagRFP-MAD2 expressed from the CMV promoterDepositorInserttagRFP-Mad2 (MAD2L1) (MAD2L1 Human)
UseLentiviralAvailable SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLEX303 GFP-PIK3C2B
Plasmid#162001PurposeLentiviral expression vector containing PIK3C2B tagged with GFPDepositorInsertPIK3C2B (PIK3C2B Human)
UseLentiviralTagseGFPMutationsiRNA resistance to siRNA#2 with 4 silent mutatio…Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL12009
Plasmid#68257PurposeLevel 0 Golden Gate Part: Promoter and 5UTR Ubiquitin (Zea mays)DepositorInsertPromoter and 5UTR Ubiquitin (Zea mays)
UseSynthetic BiologyAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Nrxn1beta AS4(-)-Fc
Plasmid#59313PurposeExpression plasmid for secreted Fc-fusion of mouse Neurexin 1beta AS4(-) [lacking the insert at alternatively spliced segment 4 (AS4-)]DepositorInsertNrxn1beta AS4(-)-Fc fusion (Nrxn1 Mouse)
TagsFc (from human IgG)ExpressionMammalianPromoterCMV, T7Available SinceJune 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pEY82
Plasmid#191077Purposeflp-7 fluorescent neural reporter driving nuclear CYOFP expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pEGFP-SRGAP1
Plasmid#187269PurposeExpression of SRGAP1-EGFPDepositorAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Nrxn1beta AS4(+)-Fc
Plasmid#59314PurposeExpression plasmid for secreted Fc-fusion of mouse Neurexin 1beta AS4(+) [containing the insert at alternatively spliced segment 4 (AS4+)]DepositorInsertNrxn1beta AS4(+)-Fc fusion (Nrxn1 Mouse)
TagsFc (from human IgG)ExpressionMammalianPromoterCMV, T7Available SinceJune 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCD5-D/bovine/Nebraska/9-5/2012-HEFwtED-GCN4-sfGFP-ST
Plasmid#175019PurposeExpresses influenza D virus trimeric hemagglutinin esterase fusion protein fused to a sfGFPDepositorInsertD/bovine/Nebraska/9-5/2012
TagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianPromoterCMVAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTY07
Plasmid#83285Purposehuman CENP-A N-terminally labeled with LSSmOrangeDepositorAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-EGFP-AP4-mito
Plasmid#229693PurposeTransient expression of EGFP AP4-mito in mammalian cellsDepositorInsertEGFP; Control construct with tandem AP4 motifs (mitochondria)
TagsEGFPExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
TagBFP2-C1-SACM1LdeltaTMD-C389S-Fis1tail
Plasmid#220079PurposeSAC1 with a C389S mutation in it with the TMD deleted and replaced with the Fis1tail to replace the TMD and target the mitochondria instead of the ER with a Blue FluorophoreDepositorAvailable SinceMay 30, 2024AvailabilityAcademic Institutions and Nonprofits only