We narrowed to 4,583 results for: bre
-
Plasmid#12270DepositorAvailable SinceJuly 20, 2006AvailabilityAcademic Institutions and Nonprofits only
-
pCAG-OSF-PP-human-CHMP3
Plasmid#154180Purposeexpresses human CHMP3 in mammalian cellsDepositorAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
P-rTetO-mCherry-T2A-RPL22-1xV5
Plasmid#170325PurposeTetracycline-inducible expression of V5 and mCherry tagged RPL22DepositorAvailable SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-ataxin-3
Plasmid#89975PurposeExpresses GFP-tagged ataxin-3DepositorAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-NfiA
Plasmid#64901PurposeInducible expression of murine CDS encoding for NfiA. Toghther with TetO-FUW-Sox9 and TetO-FUW-NfiB allows reprograming into iAstro. cells.DepositorAvailable SinceOct. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLA1
Plasmid#160807PurposeExpress POLA1DepositorAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLIK_hygro_BirA_NRF2
Plasmid#136539PurposeLentiviral expression vector for an inducible BirA-NRF2DepositorInsertBirA-NRF2 (NFE2L2 Human)
UseLentiviral; Destination vector for gateway cloningExpressionMammalianAvailable SinceJune 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #2
Plasmid#136585PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TRE3G-FNLS-PGK-Puro
Plasmid#110847PurposeLentiviral vector for dox-inducible expression of FNLS in mammalian cells (codon optimized)DepositorInsertBE3RA-FNLS
UseLentiviralTags3X FLAGMutationD10A and NLS sequence at the N-terminusPromoterTRE3GAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG_Xph20-GCaMP7f-CCR5TC
Plasmid#216534PurposeEncodes a specific PSD-95 binder (Xph20) fused to GCaMP7f, CCR5TC zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph20
TagsGCaMP7fExpressionMammalianPromoterCAGAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3/TO/V5-DEST-IGFBP2-Clover
Plasmid#191008PurposeLentiviral expression vector for IGFBP2 with a fluorescent Clover tagDepositorInsertInsulin-Like Growth Factor Binding Protein 2 (IGFBP2 Human)
UseLentiviralTagsCloverPromoterCMVAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
P-Ef1a-RPL22-3XFlag-P2A-EGFP-T2A-Puro
Plasmid#170318PurposeExpresses FLAG and EGFP tagged RPL22, puromycin resistanceDepositorAvailable SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab27B N133I
Plasmid#89449PurposeExpression of GFP-tagged human Rab27B N133I in mammalian cellsDepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
P-Ef1a-RPL22-3XHA-P2A-EGFP-T2A-Puro
Plasmid#170317PurposeExpresses HA and EGFP tagged RPL22, puromycin resistanceDepositorAvailable SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV_Syn_Xph20_eGFP_CCR5TC
Plasmid#187444PurposeEncodes a specific PSD-95 binder (Xph20) fused to eGFP, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph20
UseAAVTagseGFPExpressionMammalianPromoterSynapsinAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hADM-RFP
Plasmid#22922DepositorAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PTK7DN-VSV
Plasmid#65251PurposeExpression of VSV tagged dominant negative PTK7 in mammalian cellsDepositorAvailable SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC8 human IFN-gamma
Plasmid#17600DepositorInsertinterferon-gamma cDNA (IFNG Human)
ExpressionBacterialAvailable SinceMay 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
P-Ef1a-RPL22-3XHA-P2A-EGFP-T2A-Neo
Plasmid#170319PurposeExpresses HA and EGFP tagged RPL22, neomycin resistanceDepositorAvailable SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only