We narrowed to 10,117 results for: transfer
-
Plasmid#229604PurposeExpresses EGFP and mCherry in mammalian cellsDepositorInsertEGFP
UseAAVExpressionMammalianAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC
Plasmid#62806PurposeTo express genes at high levels in neuronal cells. This UbC promoter is more active in neurons than the promoter in CMV-based vectors.DepositorTypeEmpty backboneUseAAV; EucaryoticExpressionMammalianPromoterhUbCAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-NE2h
Plasmid#208687PurposeExpresses the genetically-encoded fluorescent norepinephrine (NE) sensor GRAB_NE2h in neuronsDepositorHas ServiceAAV5InsertGPCR activation based norepinephrine (NE) sensor GRAB_NE2h
UseAAVPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDF0338 pAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
Plasmid#172514PurposeEncodes HvsCas7-11 DR and golden gate site for spacer clonings in an AAV backbone with U6 promoterDepositorInsertpAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
UseAAVAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-iGABASnFR2n-WPRE
Plasmid#218875PurposeAAV-mediated expression of improved GABA sensor (negative change in fluorescence)DepositorInsertiGABASnFR2n
UseAAVExpressionMammalianMutationS99A F104H R168PPromoterSynapsinAvailable SinceMay 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ChRmine-mScarlet-WPRE
Plasmid#130994PurposeAAV vector to drive the expression of ChRmine-mScarlet under the control of human synapsin promoterDepositorInsertChRmine
UseAAVTagsmScarletPromoterhSynAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-EGFPL10a
Plasmid#98747PurposeCre-dependently expresses the fusion protein EGFPL10aDepositorHas ServiceAAV Retrograde and AAV5InsertEGFPL10a
UseAAV and Cre/LoxTagsGFPExpressionMammalianPromoterEF1aAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV:cTNT::Luciferase
Plasmid#69915PurposeUsed to package AAV9:cTNT::luciferase. Specifically transduce cardiomyocytes.DepositorInsertFirefly luciferase
UseAAVPromoterChicken cardiac troponin TAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVtet2_bGHpA
Plasmid#177352PurposeAAV expression of scFV-fused catalytic domain of TET2 for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 2 (TET2 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationCatalytic domains of human TET2 (1129–1936 and 14…PromoterCMV promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLY017SB_pAAV-U6sg(BbsI)-EFS-Thy1.1-P2A-SB100X
Plasmid#192151PurposeT cell CRISPR AAV-SB vectorDepositorTypeEmpty backboneUseAAVExpressionMammalianMutationNAAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_OTmut
Plasmid#185388PurposeExpresses the genetically-encoded fluorescent oxytocin(OT) control sensor GRAB_OTmut in neuronsDepositorHas ServiceAAV1 and AAV9InsertGPCR activation based oxytocin control sensor GRAB_OTmut
UseAAVPromoterhSynAvailable SinceSept. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn FLEx-OFF Kir2.1-2A-GFP
Plasmid#161580PurposeExpress Kir2.1 in cells not expressing Cre.DepositorAvailable SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hDlx_DIO_ChR2_mCherry
Plasmid#224459PurposeAn AAV vector expressing ChR2-mCherry that is dependent on both Cre and the hDlx enhancerDepositorInsertChR2-mCherry
UseAAVExpressionMammalianAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-mTagBFP2-P2A-DAAO-NES
Plasmid#217566PurposeExpression of DAAO targeted to the cytoplasm and mTagBFP2, separated by P2A self-cleaving peptide, in mammalian neuronsDepositorInsertTagBFP2-P2A-DAAO-NES
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-NS1NF
Plasmid#175279PurposeAAV vector mediating inducible expression of the NS1 gene of YFV-17DDepositorAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NIR-GECO2G
Plasmid#159605PurposeAAV production plasmid encoding for near-infrared calcium indicator NIR-GECO2GDepositorHas ServiceAAV1, AAV2, and AAV9InsertNIR-GECO2G
UseAAVExpressionMammalianPromoterCAGAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-XRI-HA
Plasmid#178056PurposeExpression Recording Islands (XRIs) for recording cellular physiological histories along intracellular protein self-assembly. Contains XRI subunit with HA tag, under UBC promoter.DepositorInsertXRI-HA
UseAAVTagsHA-MBPExpressionMammalianPromoterHuman ubiquitin C (UBC) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
YY229: pAAV_TRE::GFP- GEMINI(A)-P1N4_hSyn::rtTA3G
Plasmid#228889PurposeAAV plasmid expressing the destabilized GFP-GEMINI(A) under the control of a doxycycline-inducible promotor, and rtTA3G under the control of a hSyn promotorDepositorInsertGFP-GEMINI(A); rtTA3G
UseAAVTagsgfpPromoterTRE; hsynAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI
Plasmid#189924PurposeAAV genome encoding SaABE8eV106W and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e V106W
UseAAVMutationSaCas9 D10A, TadA ABE8e V106WPromoterEFSAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP313-pAAV-CMV-SaCas9-DIO-pA
Plasmid#113690PurposeA CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
PP_070_pAAV_CAG_LR-Voltron2-P2A-LR-CheRiff-TS-eYFP-ER2
Plasmid#203228PurposeCo-expressing membrane-localized Voltron2 and membrane-localized CheRiff.DepositorInsertMembrane-localized optopatch for neuronal dendrites
UseAAVExpressionMammalianPromoterCAGAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SspB-EGFP-VP16-P2A-FLAG-Gal4DBD-CapN-SsrA-CapC-HA
Plasmid#213536PurposeExpresses the split transcription factors in mouse liverDepositorInsertSspB-EGFP-VP16-P2A-FLAG-Gal4DBD-CapN-SsrA-CapC-HA-HA
UseAAVTagsEGFP and HAExpressionMammalianPromoterCMVAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaABE8e-bGH-U6-sgRNA-BsmBI
Plasmid#189922PurposeAAV genome encoding SaABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e
UseAAVMutationSaCas9 D10APromoterEFSAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.NES-jRGECO1a.WPRE.SV40
Plasmid#100852PurposeAAV expression of Cre recombinase-activated jRGECO1a, a red fluorescent calcium sensor protein, from the CAG promoterDepositorHas ServiceAAV1InsertjRGECO1a
UseAAVExpressionMammalianPromoterCAGAvailable SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVi U6_gRNA CMV_SadCas9-KRAB
Plasmid#214609PurposeAll-in-one AAVi plasmid expressing S. aureus dCas9-KRAB with sgRNA cassetteDepositorInsertsgRNA
SadCas9
UseAAVTagsNP NLS and SV40 NLSExpressionMammalianMutationD10A, N580APromoterCMV and U6Available SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 GfaABC1D hM3D mCherry SV40
Plasmid#92284PurposeAAV DREADD expressionDepositorAvailable SinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-cFos-XRI-V5
Plasmid#178058PurposeExpression Recording Islands (XRIs) for recording cellular physiological histories along intracellular protein self-assembly. Contains XRI subunit with V5 tag, under c-fos promoter.DepositorInsertXRI-V5
UseAAVTagsV5-MBPExpressionMammalianPromoterMouse c-fos promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.Twitch2B.WPRE.SV40
Plasmid#100039PurposeAAV expression of FLEXed Twitch2B driven by CAG promoter. Twitch 2B is a fluorescent reporter for calcium signalingDepositorInsertTwitch2B
UseAAVExpressionMammalianPromoterCAGAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only