We narrowed to 2,594 results for: gem

#110301

Mammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)

Chris Kok-Lung Chan

Tiwari et al Nat Commun. 2018 Feb 14;9(1):677. doi: 1

May 23, 2018

Academic Institutions and Nonprofits only

#35504

AAV expression of Ef1a-driven, cre-dependent, stabilized step function opsin (SSFO) for optogenetic activation.

Karl Deisseroth

Yizhar et al Nature. 2011 Jul 27;477(7363):171-8. doi

April 18, 2012

Academic Institutions and Nonprofits only

#169226

Targeting vector backbone to support a knock-in of mNeongreen-Linker at the N-terminus of a target locus

Hugo Snippert

Bollen et al PLoS Biol. 2022 Jan 28;20(1):e3001527. d

Jan. 3, 2022

Academic Institutions and Nonprofits only

#177013

Generate baculovirus for insect cell expression of CKS1 with N-terminal Polyhistidine-TEV

Andrea Musacchio

Huis In 't Veld et al Protein Sci. 2021 Nov 17. doi: 10.1002/p

Nov. 29, 2021

Academic Institutions and Nonprofits only

#154945

Optogenetic tool for blue-light inhibition and red-light excitation of neurons

Simon Wiegert

Vierock et al Nat Commun. 2021 Jul 26;12(1):4527. doi:

Aug. 2, 2021

Academic Institutions and Nonprofits only

#35503

AAV expression of Ef1a-driven, cre-dependent, stabilized step function opsin (SSFO) for optogenetic activation.

Karl Deisseroth

Yizhar et al Nature. 2011 Jul 27;477(7363):171-8. doi

April 23, 2012

Academic Institutions and Nonprofits only

#71268

Entry clone containing Turqoise2. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway system

Ari Pekka Mähönen

Siligato et al Plant Physiol. 2015 Dec 7. pii: pp.01246

Dec. 7, 2015

Academic Institutions and Nonprofits only

#71267

Entry clone containing the GUS enzyme. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway system

Ari Pekka Mähönen

Siligato et al Plant Physiol. 2015 Dec 7. pii: pp.01246

Dec. 7, 2015

Academic Institutions and Nonprofits only

#206252

Expression of 7 fluorescently labelled proteins in mammalian cells. Can be used to generate recombinant baculovirus particles.

Imre Berger

Aulicino et al Nucleic Acids Res. 2022 Jul 22;50(13):77

Sept. 27, 2023

Academic Institutions and Nonprofits only

#169219

Targeting vector backbone to support a knock-in of Linker-mScarlet at the C-terminus of a target locus

Hugo Snippert

Bollen et al PLoS Biol. 2022 Jan 28;20(1):e3001527. d

Jan. 3, 2022

Academic Institutions and Nonprofits only