We narrowed to 6,278 results for: tTA
-
Plasmid#117327PurposeDual luciferase assay positive control for miR-124 bindingDepositorInsertmiR-124 sponge
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-miR-124-sponge_rev(neg. CTRL)
Plasmid#117326PurposeDual luciferase assay negative control for miR-124 bindingDepositorInsertreverse miR-124 sponge
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJ4M/TDP-43 S48E
Plasmid#104481Purposebacterial expression of TDP-43 S48EDepositorAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-2B-Gata4
Plasmid#98615PurposeGateway entry vector for Gata4DepositorInsertGata4 (Gata4 Mouse)
UseEntry vectorAvailable SinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
DCP2
Plasmid#155499PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5
Plasmid#170850PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of any transgene in cortical interneurons under the control of the Dlx enhancer.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6
Plasmid#170851PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of any transgene in cortical interneurons under the control of the Dlx enhancer.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetpA-hNEUROG2-iRPT
Plasmid#140764PurposeExpresses iRFP713, PuroR and rtTAM2 in mammalian cells, with TRE-hNEUROG2DepositorInsertsExpressionMammalianAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-GCaMP6f
Plasmid#178730PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GCaMP6f in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_NTD1-80_Y4R
Plasmid#104478Purposebacterial expression of TDP-43 NTD Y4RDepositorAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-dTom
Plasmid#178717PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of dTom in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertdTom
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLgw EcoDam-V5-SRF
Plasmid#98602PurposeMammalian DamID lentiviral vector forSRF with Dam-V5 using Gateway cloningDepositorInsertSRF (Srf Mouse)
UseLentiviral; DamidTagsDam (DNA adenine methyltransferase) and V5ExpressionMammalianPromoterHeat Shock Minimal PromoterAvailable SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1_sh_ex15
Plasmid#35166DepositorAvailable SinceMarch 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-dTom
Plasmid#178719PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of dTom in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertdTom
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6-dTom
Plasmid#178720PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of dTom in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertdTom
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-GFP
Plasmid#178712PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-lincRNA-RoR-sh1 (Linc-sh1)
Plasmid#45764DepositorAvailable SinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.SV40.THBS1-deltaTSR3-CTD-HA.SV40(polyA)
Plasmid#155194PurposeExpresses truncated (AA 1-690) murine Thrombospondin-1 (THBS1) protein with HA-tag at C-terminusDepositorInsertThrombospondin-1 (Thbs1 Mouse)
UseAAVTagsHA-tagExpressionMammalianMutationTruncated sequence of THBS1 (expresses Amino Acid…PromoterCMVAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.SV40.THBS1-deltaCC-HA.SV40(polyA)
Plasmid#155195PurposeExpresses murine Thrombospondin-1 (THBS1) protein with deletion of Coiled Coil domain and HA-tag at C-terminusDepositorInsertThrombospondin-1 (Thbs1 Mouse)
UseAAVTagsHA-tagExpressionMammalianMutationTHBS1 with deletion of amino acid residues 276-315PromoterCMVAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only